Biology 107 Spring 2021 Lab Week 3 Discussion Week of Feb 1 Topics Central Dogma Open Reading Frames and Genes 1 What s the difference between an open reading frame and a gene Do all translated coding genes have to have an open reading frame Open reading frame start and stop and everything However long you get before stopping the codon Gene coding for a protein Open reading frames ORFs are parts of a reading frame that contain no stop codons A reading frame is a sequence of nucleotide triplets that are read as codons specifying amino acids a single strand of DNA sequence has three possible reading frames 2 How are there 6 different reading frames in DNA when there are only 2 strands of DNA The longer an open reading frame is the longer you get before you get to a stop codon the more likely it is to be part of a gene which is coding for a protein So it s actually six different reading frames for every piece of DNA which might give you an open reading frame DNA model to help you think about this question 5 TCAACATGGATGCCGTATAGCCTAGGCATCTAA 3 3 AGTTGTACCTACGGCATATCGGATCCGTAGATT 5 3 Why is it unlikely that there are overlapping genes in the DNA even though there are 6 reading frames means that the same letter is not used for two different codons In other words no single base can take part in the formation of more than one codon Prosocial 2 Spring 21
View Full Document
Unlocking...