BIOL 111 1st Edition Lecture 14 Outline of Last Lecture I. Before Mendel (<1860s)—ideas about inheritanceII. Gregor Mendel (1822-1884): the Revolutionary monkIII. MeiosisIV. How to geneticists represent alleles?V. Law of segregation Outline of Current Lecture I. Section IV Review: Molecular BiologyII. The Central DogmaIII. The genetic codeIV. Self quizV. Transcription—making mRNAVI. Synthesis of transcriptionVII. Processing RNA in the nucleusVIII. Consequences of RNA splicingCurrent Lecture- Section IV Review: Molecular Biologyo Bridging the gap between DNA and traitso Central dogma of molecular biologyo How are these processes controlled?o How is this information used in the “real world”?- The Central Dogmao DNAmRNAProtein Monomers: Nucleic acidnucleic acidamino acids DNAmRNA goes through transcription mRNAamino acids goes through translationo Differences in prokaryotes vs. eukaryotes? Present of nucleus in eukaryotes and will make a difference in the transcription and translation process In a prokaryote, transcription and translation occurs at the same time The nuclear envelope separates the process of transcription/RNA processing (occurs inside the envelope) and translation (occurs outside the envelope)- The genetic codeo How many monomers in the molecule of inheritance? There are 4 monomers (ATCG)o How many monomers in the product of translation?o How do you code for 20 amino acids with just 4 nucleic acids?o Triplet code Nt(4) X nt(4) X nt(4) = 64 codon codes Some codons code for the same amino acids Be able to read codon chart (Fig. 17.5) ORF (open reading frame)=- Start codon + series of codons + stop codon (amino acid) + (amino acid) Codon: 3 nucleotide sequence that specifies a particular amino acid or stop signal Know:- AUG=start codon- UAA, UAG, UGA=stop codons- Self quizo A DNA template strand reads: 3’ TACGTACCGTAATGCCCCATC 5’o What is the sequence of the mRNA that will be transcribed from this sequence of DNA? 5’ AUGCAUGGCUAAUCGGGGUAG 5’o What peptide will be translated from the mRNA Start codon-HIS-GLY-stop codon-SER-GLY-stop codon- Transcription—making mRNAo Molecular components DNA template- Promoter- Terminator RNA polymerase Ribonucleotides (AKA: RNA nucleotides- Synthesis of transcriptiono Initiation Promoter (TATA box)-a eukaryotic promoter includes a TATA box Transcription factors-several transcription factors must bind to the DNA before RNA polymerase II can do so RNA polymerase II-additional transcription factors bind to the DNA along with RNA polymerase II- RNA polymerase-unwinds DNA, reads DNA, synthesizes RNA (only 5’3’) does not need primero Termination of transcription Prokaryotes: reads terminator sequence and detaches Eukaryotes: read polyadenylation sequence and beyond before detaching- Processing RNA in the nucleuso Modifying the ends Functions: facilitate export to cytoplasm, prevent degradation, help ribosomes attach to mRNA Types of modifications: 5’ cap, polyadenalated tail (also note: 5’ and 5’ UTR)o Modifying the middle (Figs 17.10, 17.11) RNA splicing Exons-expressed portions of transcript Introns-in between expressed portions Spliceosome - Composed of proteins and snRNAs (small nuclear RNA)- Cuts out introns- Consequences of RNA splicingo Alternative splicing possibleOne gene=2 or more
View Full Document
Unlocking...