BIOL 111 1st Edition Lecture 14 Outline of Last Lecture I Before Mendel 1860s ideas about inheritance II Gregor Mendel 1822 1884 the Revolutionary monk III Meiosis IV How to geneticists represent alleles V Law of segregation Outline of Current Lecture I Section IV Review Molecular Biology II The Central Dogma III The genetic code IV Self quiz V Transcription making mRNA VI Synthesis of transcription VII Processing RNA in the nucleus VIII Consequences of RNA splicing Current Lecture Section IV Review Molecular Biology o Bridging the gap between DNA and traits o Central dogma of molecular biology o How are these processes controlled o How is this information used in the real world The Central Dogma o DNA mRNA Protein Monomers Nucleic acid nucleic acid amino acids DNA mRNA goes through transcription mRNA amino acids goes through translation o Differences in prokaryotes vs eukaryotes Present of nucleus in eukaryotes and will make a difference in the transcription and translation process In a prokaryote transcription and translation occurs at the same time The nuclear envelope separates the process of transcription RNA processing occurs inside the envelope and translation occurs outside the envelope The genetic code o How many monomers in the molecule of inheritance There are 4 monomers ATCG o How many monomers in the product of translation o How do you code for 20 amino acids with just 4 nucleic acids o Triplet code Nt 4 X nt 4 X nt 4 64 codon codes Some codons code for the same amino acids Be able to read codon chart Fig 17 5 ORF open reading frame Start codon series of codons stop codon amino acid amino acid Codon 3 nucleotide sequence that specifies a particular amino acid or stop signal Know AUG start codon UAA UAG UGA stop codons Self quiz o A DNA template strand reads 3 TACGTACCGTAATGCCCCATC 5 o What is the sequence of the mRNA that will be transcribed from this sequence of DNA 5 AUGCAUGGCUAAUCGGGGUAG 5 o What peptide will be translated from the mRNA Start codon HIS GLY stop codon SER GLY stop codon Transcription making mRNA o Molecular components DNA template Promoter Terminator RNA polymerase Ribonucleotides AKA RNA nucleotides Synthesis of transcription o Initiation Promoter TATA box a eukaryotic promoter includes a TATA box Transcription factors several transcription factors must bind to the DNA before RNA polymerase II can do so RNA polymerase II additional transcription factors bind to the DNA along with RNA polymerase II RNA polymerase unwinds DNA reads DNA synthesizes RNA only 5 3 does not need primer o Termination of transcription Prokaryotes reads terminator sequence and detaches Eukaryotes read polyadenylation sequence and beyond before detaching Processing RNA in the nucleus o Modifying the ends Functions facilitate export to cytoplasm prevent degradation help ribosomes attach to mRNA Types of modifications 5 cap polyadenalated tail also note 5 and 5 UTR o Modifying the middle Figs 17 10 17 11 RNA splicing Exons expressed portions of transcript Introns in between expressed portions Spliceosome Composed of proteins and snRNAs small nuclear RNA Cuts out introns Consequences of RNA splicing o Alternative splicing possible One gene 2 or more proteins
View Full Document
Unlocking...