Emma Chesley Collaborated with Daniel Carballo and Anna Frederich Fall 2014 7 012 Problem Set 5420 Points total Question 1 4 points DUE WEDNESDAY 11 05 2014 AT 9 45AM ONLINE You want to amplify the DNA fragment below using PCR Five short sequences from parts of the top strand are shown The size of the DNA sequence between the short 54base pair sequences is also given These fragments are named A4E see below The figure is not drawn to scale A B C D E 5 ATCGA 200bp GCCAT 500bp CCGTC 300bp ATATA 700bp GTCTA 900bp AAATC 3 3 5 a For the primer sets below choose the set that would allow you to clone the entire DNA fragment about 2600 base pairs shown here Primer set 14 5 4GCCAT43 and 5 4GATTT43 Primer set 24 5 4ATCGA43 and 5 4AAATC43 Primer set 34 5 4ATATA43 and 5 4GATTT43 Primer set 44 5 4TCGAT43 and 5 4AAATC43 Primer set 54 5 4ATCGA43 and 5 4GATTT43 b For your chosen primer set from part 1a indicate which primer binds to the top strand and which primer binds to the bottom strand c Indicate the size of the DNA fragment generated if you carry out PCR amplification using the primer sets below Primer set 14 5 4TATAT43 and 5 4CCGTC43 Primer Set 24 5 4GACGG43 and 5 4ATCGA43 d Give the sequence of the primers that would allow you to amplify the region BCD This region includes the intervening 5 base pair sequences between the B C and D fragments Clearly indicate the 5 and the 3 ends on the primer Primer set 1 would produce a length of 310bp Primer set 2 would produce a length of 715bp ATCGA binds to the bottom and GATTT binds to the top 5 GCCAT TAGAC 3 1 e Draw all the different types of newly synthesized DNA that would be generated by DNA polymerase after one cycle of PCR using the primers described in part 3d You don t have to write the intervening 5bp sequence between the fragments Indicate whether each product matches the top strand or bottom strand respectively Clearly label the 5 and 3 ends of the products strand should be indicated as 5BABCB3 top Question 2 2 points You are sequencing a hypothetical gene X and you observe the results below The labeled strands are the strands you obtain as a result of your sequencing reaction Note that the posted pdf is in color and you will need to be able to view the document in color to answer the question For example your answer for a fragment ABC that matches the top 5 BCDE 3 bottom and 3 ABCD 5 top ddTTP ddCTP Capillary tube with sample for sequencing ddATP ddGTP Labeled strands Shortest fragment Longest fragment In the schematic above a Show the direction of DNA strand synthesis by an arrow and label the 5 and the 3 ends by filling in the boxes b Write the sequence of the double4stranded DNA derived from the schematic above Label the 5 and 3 ends 5 TACCTAGCGTG 3 3 ATGGATCGCAC 5 2 We should use CDNA because the gene is found in eukaryotes and because the clones contain only the coding sequences of the gene because the introns have been spliced out Question 3 5 points You have recently read about the human protein TAS2R which is associated with the ability to taste sour foods You want to express the TAS2R gene in bacteria and study it further To do so you plan to clone TAS2R gene into a bacterial plasmid a To clone TAS2R into the bacterial plasmid you can either use the genomic fragment for the TAS2R gene or the TAS2R cDNA What would you choose for your experiment and why b What kind of promoter eukaryotic or prokaryotic should you use to express the TAS2R gene in bacteria You want to ligate the TAS2R DNA fragment to a piece of DNA encoding green fluorescent protein GFP The GFP DNA fragment has specifically been modified to express in bacteria You want to generate a fusion protein such that the GFP protein is attached to the C4terminus of TAS2R This will produce a slightly longer protein see diagram below Note that losing or gaining a few amino acids from the end of TAS2R or start of GFP will not negatively impact the function of the fusion protein Direction of transcription GFP gene GFP gene TAS2R TAS2R We should use a prokaryotic promoter to express the TAS2R gene in the bacteria since bacteria are prokaryotes and are the organisms expressing the gene 3 Below is the part of the cDNA sequence that encodes the C terminus of TAS2R The sequence encoding the stop codon is shown in bold and highlighted in red The bars above the sequence show the restriction enzyme recognition sites 5 TCAAGAGGATCCCCGCGGTACCGAATTCCATGTTATAGCAAGCTCGGAATTAACCCTCAC 3 3 AGTTCTCCTAGGGGCGCCATGGCTTAAGGTACAATATCGTTCGAGCCTTAATTGGGAGTG 5 BamHI EcoRI KpnI Below is the part of the cDNA sequence that encodes the N terminus of GFP Your cloning will attach the GFP sequence to the end of the TAS2R gene sequence so a start codon in the GFP sequence is not needed The bars above the sequence show the restriction enzyme recognition sites The underlined triplet highlighted in green indicates the reading frame of GFP BamHI KpnI EcoRI EcoRI 5 G AATT C 3 3 C TTAA G 5 5 TCTAGAGGATCCGTGGTACCGGGTACGAATTCCGGTGCCAAGCGGCGTG 3 3 AGATCTCCTAGGCACCATGGCCTTAGCTTAAGGCCACGGTTCGCCGCAC 5 The recognition sequences and the cleavage sites indicated by for each enzyme are given below c You want to ligate these two pieces of DNA together to create a version of the TAS2R protein that has GFP attached to the C terminus in a manner that maintains the reading frame Which enzyme or enzymes can you use to cut the TAS2R gene List all that apply cut the DNA for GFP List all that apply KpnI 5 G GTAC C 3 3 C CATG G 5 BamHI 5 G GATC C 3 3 C CTAG G 5 BamHI BamHI 4 Question 4 9 points You successfully created a DNA fragment that encodes the human TAS2R gene fused to GFP from question 3 You plan to clone this fragment into a vector that will allow you to express it in bacterial cells Your plan is to 1 Cut an appropriate vector and the DNA fragment with PvuII 2 Ligate the cut vector and the fragment together 3 Transform E coli cells with the ligation mix 4 Select for E coli cells that have a plasmid 5 Identify the E coli cells carrying a recombinant plasmid containing the inserted fragment by screening The following is a partial schematic of vector 1 that will allow you to complete the plan outlined above The TetR gene confers resistance to the drug tetracycline The AmpR gene confers resistance to the drug ampicillin a To allow selection for E coli cells that have any plasmid step 4 and screening for E coli cells with the recombinant plasmid containing the inserted fragment step 5 you will transform a particular strain of E
View Full Document
Unlocking...