Name:____________________________ 1 2006 7.012 Problem Set 4 Due before 5 PM on FRIDAY, October 27, 2006. Turn answers in to the box outside of 68-120. PLEASE WRITE YOUR ANSWERS ON THIS PRINTOUT. 1. You are studying a specific gene in yeast, and you want to express that yeast gene in E. coli. Your task is to design a strategy to insert the yeast gene into the bacterial plasmid. Below is a map of the area of the yeast genome surrounding the gene in which you are interested. yeast promoter Gene is normally transcribed this way S X K N E X N The distance between each tick mark placed on the line above is 100 bases in length. Below are the enzymes you can use, with their specific cut sites shown 5’-XXXXXX-3’ 3’-XXXXXX-5’ This is the map of the plasmid. Bacterial promoter The plasmid is 5,000 bases long and the two farthest restriction enzyme sites are 200 bases apart. The plasmid has an ampicillin resistance gene somewhere on the plasmid distal from the restriction cut sites. S K X E N Xba I: Nde I: Sal I: EcoR I: Xho I: Kpn I: TCTAGA CATATG GTCGAC GAATTC CTCGAG GGTACC AGATCT GTATAC CAGCTG CTTAAG GAGCTC CCATGGName:____________________________ 2 (a) Which single restriction enzyme is the best choice for you use to design a way to get the insert into the vector if you can only use one single enzyme? Keep in mind that your goal is to have the yeast gene be expressed in the bacterial cells. (b) You follow the cloning strategy you chose in part (a). You do the digestion of the insert and the vector and then ligate the two digestions together. You then transform the ligation into bacteria and select for ampicillin resistance. You get three colonies on your transformation plate. You isolate plasmid from each one and cut each plasmid with the enzyme XbaI. You then run your three digestions on an agarose gel and see the following patterns of bands. Describe what each plasmid actually was that was contained in each of the three colonies. colony 1 colony 2 colony 3 Colony 1’s plasmid = Colony 2’s plasmid = Colony 3’s plasmid = 5000 nts 4000 nts 3000 nts 2000 nts 1000 nts 500 ntsName:____________________________ 3 (c) Which colony’s plasmid do you actually want to use for your studies? (d) Which two restriction enzymes would you use to design a way to get the insert into the vector if you had to use two enzymes simultaneously? (e) You transform your ligation planned in part (d) into bacteria and plate the bacteria on Petri plates containing ampicillin. (You actually transform six different ligation mixtures, which are described below, into six different populations of cells, and plate each transformation onto a different plate, because you want to do all of the correct controls.) The next day you come in to lab to look at how many colonies of bacteria are on each plate. You are really excited, because the number of colonies you see on each plate tells you that the entire procedure worked! Which of the three following patterns of number of colonies did you see in order to conclude that you had a successful transformation? Circle the correct pattern. In this table, DV = digested vector. DYG = digested yeast genome. Ligation Used Pattern 1 Pattern 2 Pattern 3 DV only + Ligase 200 0 0 DYG only + Ligase 0 200 0 Water + Ligase 0 0 0 DV + DYG + Ligase 200 200 200 DV + DYG (NO ligase) 0 0 0 Undigested vector + Ligase 0 0 200Name:____________________________ 4 2. You are practicing designing primers that you can use in PCR reactions. You want your primers to allow you to amplify the sequence found below. 5’-ACTTCGATATGTCTAAAATACGATCGATCTGTGGGGCCTAGCTAGCTAACCAGAGACGCTACCG-3’ 3’-TGAAGCTATACAGATTTTATGCTAGCTAGACACCCCGGATCGATCGATTGGTCTCTGCGATGGC-5’ Left primer should Right primer should anneal to this region anneal to this region Draw into the following gel lanes what size(s) of PCR products you would get if you used the following primers stated in parts (a), (b), and (c) to do a PCR reaction on the template DNA shown above. Markers part (a) part (b) part (c) (a) 5’-ACTTCGATATGTCTAAAATAC-3’ and 5’- CGGTAGCGTCTCTGGTTAGCT -3’ (b) 5’-TGAAGCTATACAGATTTTATG-3’ and 5’-GCCATCGCAGAGACCAATCGA-3’ (c) 5’-GTATTTTAGACATATCGAAGT -3’ and 5’-AGCTAACCAGAGACGCTACCG-3’ (d) You are asked to design a 15-nucleotide-long primer that could potentially hybridize to a portion of a specific mRNA that encodes the protein sequence N-Met-Ala-Tyr-Trp-Pro-C. How many different primers would you have to design in order to ensure that one of them will in fact hybridize along its full length to the mRNA? 87 nts 80 nts 70 nts 60 nts 50 nts 40 nts 27 ntsName:____________________________ 5 3. You are a scientist who is using genomics to currently study a new bacterial species that no one has ever studied before. The following sequence is a piece of DNA within the coding region of a gene that you have recently sequenced. 5’-CCCGTACGTTTACGCCGTATATATCGTCGTAATCCTACGTAGCTCTACGAACA-3’ 3’-GGGCATGCAAATGCGGCATATATAGCAGCATTAGGATGCATCGAGATGCTTGT-5’ (a) If you take any bacterial gene sequence, before you begin doing any sequence analysis on it, there are six potential open reading frames. Why are there six? (b) How many of the 6 potential open reading frames are actually open in this sequence shown above? (c) You are using shotgun sequencing to determine the DNA sequence of the genome of this new bacterial species. For one strand of a 30-nucleotide long stretch of DNA, you get the following sequences out of your shotgun sequencing reaction. Assemble the entire 30-nt-long DNA sequence you are trying to sequence, and write the full sequence of the DNA. You only need to write the one strand that is shown; please make sure to label the 5’ and 3’ ends of that one strand. 5’-GGAGTTCCTC-3’
View Full Document
Unlocking...