C T G A Question 1 3 points 23 30 29 11 0 Genome 1 Genome 2 Genome 3 Genome 4 Genome 5 Fall 2014 7 012 Problem Set 3 20 Points total DUE FRIDAY 10 10 2014 AT 9 45AM ONLINE Name Suppose you are working in a lab that studies the base composition of different genomes You look at the percent base composition of 5 different genomes and you get the data shown in the table below You know that three of the genomes are bacterial and 2 are viral 27 27 23 20 24 26 21 29 21 39 11 39 25 20 19 a Based on this information determine which genomes are bacterial and which genomes are viral Explain your answer b Give a possible explanation for why you see 0 percent T for genome 5 Is it possible that this genome only has 3 bases c How could you test your hypothesis in part b d You calculate the total number of hydrogen bonds between bases for all bacterial genomes You find out that one of the bacterial genomes has significantly more hydrogen bonds as compared to the other two genomes Based on the data provided can you identify this genome Explain your answer DNA replication is semiconservative Each DNA helix contains one old strand and one newly synthesized strand The conservative model of DNA replication was also considered before the MeselsonUStahl experiment According to this model the double stranded DNA helix serves as a template to produce a new helix Replication produces two DNA helixes one comprised entirely of old DNA and the other one comprised entirely of new DNA Note9this model is not correct 1 Question 2 5 points Bacterial Genome 1 Genome 3 Genome 4 the equal base composition means that it is double stranded and therefore it is bacterial Viral Genome 2 Genome 5 the unequal base composition means that it is single stranded and therefore it is viral The virus in Genome 5 is encoded in RNA and RNA does not have the T base but rather the U base Check for the percentage of U which should be 36 100 20 25 19 36 There are more hydrogen bonds formed between Cytosine and Guanine therefore the genome with the most hydrogen bonds is in Genome 4 Name a The diagram below depicts tubes containing the denoted samples in a cesium chloride gradient after ultracentrifugation Draw the bands you expect to see in tube 2 and 3 if DNA replicates via a conservative model If you notice more than one band in tube 2 and or 3 comment on their relative thickness Tube 2 Equal size lines for N15 N14 Tube 3 Thin line at N15 and a thick line at N14 Tube 3 Tube 1 Tube 2 Cells grown only in 15N containing media Cells grown in 15N containing media and then in14N containing media for one generation Cells grown in 15N containing media and then in14N containing media for ten generations b A schematic of an origin of replication is shown below The arrow indicates the direction of DNA replication Label the 5 end and 3 end of all DNA strands c Suppose you are carrying out the replication of this fragment of DNA in a tube You add all the necessary components and enzymes for this process but you leave out DNA ligase Which strand would the absence of ligase affect Your answer options are top bottom neither or both Explain your answer Without DNA ligase the lagging strand would be affected because there would be no enzyme to catalyze the formation of the phosphodiester linkage that joins the Okazaki fragments In the case above the lagging strand is the bottom strand in Region 1 and the top strand in Region 2 therefore both strands will be affected but in different regions 2 14N 15N Phenotype the DNA is unable to preform replication Name d You are considering deleting the gene encoding the ligase enzyme in bacteria What would you expect the phenotype of these bacterial cells to be e You find out that if you grow E coli using a growth medium supplemented with a certain substrate A they appear blue This happens because bacteria produce an enzyme that converts substrate A into the blue color You then come across a mutated strain of E coli in which the exonuclease activity of the DNA polymerase has been compromised You plate these cells in medium containing substrate A and notice that the majority of the single colonies are blue However you also observe a few white colonies Give a possible explanation for the appearance of the white colonies Ampicillin is an antibiotic used widely in treating bacterial infections Ampicillin kills bacteria by interfering with the synthesis of the cell wall Without a proper cell wall bacterial cells will lyse and die However bacteria that contain the gene bla are resistant to the antibiotic ampicillin This happens because the protein encoded by bla betaUlactamase destroys ampicillin and allows bacteria to survive and propagate in its presence Below is shown a fragment of the bla gene A part of its promoter has been also labeled with a box Without exonuclease E coli there is no mechanism by which a damage in the DNA can be dealt with Because of this there can be mutations which are extremely rare that result in a few white colonies Question 3 7 5 points 5 CTTTTTGCGTTTCTACAAACTCTTTTGTTTATTTTTCTAAATACATTCAAATATGTATCCGC 3 3 GAAAAACGCAAAGATGTTTGAGAAAACAAATAAAAAGATTTATGTAAGTTTATACATAGGCG 5 5 TCATGAGACAATAACCCTGATAAATGCTTCAATAATATTGAAAAAGGAAGAGTATGAGTATT 3 3 AGTACTCTGTTATTGGGACTATTTACGAAGTTATTATAACTTTTTCCTTCTCATACTCATAA 5 5 CAACATTTCCGTGTCGCCCTTATTCCCTTTTTTGCGGCATTTTGCCTTCCTGTTTTTGCTCA 3 3 GTTGTAAAGGCACAGCGGGAATAAGGGAAAAAACGCCGTAAAACGGAAGGACAAAAACGAGT 5 5 CCCAGAAACGCTGGTGAAAGTAAAAGATGCTGAAGATCAGTTGGGTGCACGAGT 3 3 GGGTCTTTGCGACCACTTTCATTTTCTACGACTTCTAGTCAACCCACGTGCTCA 5 a From the information above do you know the direction in which RNA polymerase moves in transcribing the bla gene If the answer is yes does it transcribe to the left of the promoter or to the right of the promoter If the answer is no explain why We cannot tell the direction of transcription 3 The top strand is the coding strand The bottom strand is the template for transcription Name b You are told that the first transcribed nucleotide is a uracil and this is transcribed from the first nucleotide outside the boxed region Indicate which strand top or bottom is the coding strand c Which strand is the template strand for transcription d Write down the first ten nucleotides of the mRNA Remember that the first nucleotide is a uracil transcribed from the first nucleotide outside the boxed region Clearly label the 5 and 3 ends e Write down the first three amino acids produced from the betaUlactamase gene The amino acid codon chart is provided on the
View Full Document
Unlocking...