Name: ______________KEY_______________ 1 7.012 Exam Two KEY -- 2006 Exam starts at 10:05 am and ends at 10:55 am. There are 9 pages including this cover page & the genetic code. Please write your name on each page. Only writing on the FRONT of every page will be graded. (You may use the backs, but only as scratch paper.) Question 1 24 pts________ Question 2 11 pts________ Question 3 24 pts________ Question 4 25 pts________ Question 5 16 pts________ TOTAL out of 100_______Name: ______________KEY_______________ 2 1. (24 pts) You are working with a piece of DNA of the sequence: 5’-TATTGAGCTCCCGGAT-3’ 3’-ATAACTCGAGGGCCTA-5’ (a, 5 pts) You cut the above piece of DNA with a restriction enzyme that recognizes the sequence 5’-GAGCTC-3’ and cuts on the 3’ side of the A within this sequence. Draw all products that result from this digestion. Make sure to draw the nucleotide sequence of both strands, and label all 5’ and 3’ ends. 5’-TATTGA-3’ 5’-GCTCCCGGAT-3’ 3’-ATAACTCG-5’ 3’-AGGGCCTA-5’ (b, 5 pts) Now you ligate the DNA you produced in part (a) to the sequence below, which you have also cut with the same restriction enzyme. Draw the shortest DNA product that could form from ligating a piece of DNA from part (a) to a piece of DNA from part (b). Make sure to draw the nucleotide sequence of both strands, and label all 5’ and 3’ ends. 5’-TAGAGCTCCGCAATG-3’ 3’-ATCTCGAGGCGTTAC-5’ This sequence becomes the following when cut: 5’-TAGA-3’ 5’-GCTCCGCAATG-3’ 3’-ATCTCG-5’ 3’-AGGCGTTAC-5’ The shortest product of ligation would be if you ligated the piece on the left from part (b) to the piece on the left from part (a). To do this, you have to flip the piece from part (a) on the left around so that its sticky ends line up with those of the piece from part (b). 5’-TAGA-3’ 5’-GCTCAATA-3’ 3’-ATCTCG-5’ 3’-AGTTAT-5’ giving the final answer 5’-TAGAGCTCAATA-3’ 3’-ATCTCGAGTTAT-5’ (c, 6 pts) Restriction enzymes have DNA binding domains. Name three other different types of proteins (that are not restriction enzymes) that have DNA binding domains. Acceptable answers are any proteins whose job it is to act upon DNA. These include: activators and/or repressors (which are both transcription factors), DNA polymerase, RNA polymerase, helicase, primase, ligase, topoisomerase, telomerase, histones (part of the nucleosome), nuclease, DNA repair enzymes, and methylase.Name: ______________KEY_______________ 3 Which reaction is catalyzed by each of the enzymes listed below? Answer by stating which specific type of bond is affected (e.g. “covalent” is not specific enough), and whether each enzyme catalyzes the formation or the breaking of that type of bond. (d, 4 pts) the T. aquaticus “Taq” polymerase used in PCR Formation of phosphodiester bonds. (PCR is just many rounds of DNA replication.) (e, 4 pts) a restriction enzyme Breaking of phosphodiester bonds. 2. (11 pts) Below is shown a picture of a replication bubble. (a, 3 pts) The primer 5’-CUU-3’ is being used to replicate this piece of DNA. Would that primer anneal to the upper strand of DNA in the picture or the lower strand? The lower strand. The sequence 5’-CUU-3’ would basepair to its antiparallel complement, 3’-GAA-5’, which only exists at the site bolded above. (b, 5 pts) Write what the product of DNA replication would be if the first five nucleotides had been added onto this primer by DNA polymerase. Label the 5’ and 3’ ends. Make sure to include the primer. 5’-CUUGTTAC-3’. Replication proceeds 5’--> 3’, such that nucleotides are always added on to the 3’ end of the primer. This is DNA replication, so the nucleotides added on to the RNA primer are deoxyribonucleotides. (c, 3 pts) Would that strand that you have drawn in part (b) be a leading strand or a lagging strand? A T A T T G T C C T A T A A C A G G C A T T C A T T G A G T A T G A A C 3’ 5’ … … … …Name: ______________KEY_______________ 4 A leading strand. DNA replication occurs in a “leading fashion” when the direction of fork opening by helicase is the same direction as replication is occurring. This allows replication to keep on going continuously, as helicase unwinds more and more DNA. Helicase would be unwinding in these two directions: and to expand this replication bubble, and our strand is replicating this way: so it must be a leading strand. 3. (24 pts) You are studying a very short protein-encoding gene whose sequence is shown below. The region of sequence shown is from the transcriptional start site to the transcriptional stop site. The gene’s one small intron is shown for you in bold. 5’-CTACGTACTAGCTATTCCGATCTATACTCGATCTAGTCGCATTCCGATTCGATCGTAC-3’ 3’-GATGCATGATCGATAAGGCTAGATATGAGCTAGATCAGCGTAAGGCTAAGCTAGCATG-5’ (a, 4 pts) Which strand is used as a template in transcription, the upper strand or the lower strand? The upper strand. The only strand that has a start codon (5’-ATG-3’, bolded and underlined above) is the bottom strand, so the bottom strand must look like the mRNA. This means that the upper strand is the one that is used as a template. (b, 4 pts) How many nucleotides long would the final processed mRNA made from this gene be (not including the 5’ cap and the 3’ polyA tail)? 50 nucleotides. The sequence shown goes from the transcriptional start site to the transcriptional stop site. Thus the whole 58 nucleotides are transcribed, but then the 8 nucleotides of the intron are spliced out, leading to a final mRNA of 50 nucleotides, which looks like this: 5’- GUACGAUCGAAUCGGAAUGCGACUAGAUCGAGGGAAUAGCUAGUACGUAG-3’ (c, 4 pts) How many amino acids long would the protein product of this gene be? 8 amino acids. The mRNA looks like this after splicing the intron out: 5’-GUACGAUCGAAUCGGAAUGCGACUAGAUCGAGGGAAUAGCUAGUACGUAG-3’ The AUG encodes methionine, the first amino acid. You then have seven other codons that code for amino acids until the stop codon. 1st codon: AUG 2nd codon: CGA 3rd codon: CUA 4th codon: GAU 5th codon: CGAName: ______________KEY_______________ 5 6th codon: GGG 7th codon: AAU 8th codon: AGC stop codon: UAG (d, 4 pts) What is the sequence of the anticodon of the tRNA that would bind to the third codon of this mRNA as it was being translated?
View Full Document
Unlocking...