President Clinton Comes to Cal Jan 29 2002 I was honored to be president at the time when the International Consortium of Scientists finished the sequencing of the human genome something which has already yielded the two major variances that are high predictors of breast cancer something that is leading us very close to unlocking the genetic strains that cause Parkinson s and Alzheimer s And quite soon young women will come home from the hospital with their newborn babies in countries with good health systems with little gene cards that will say Here are your child s strengths and weaknesses and if you do the following ten things your baby has a life expectancy of 93 years This is going to happen in the lifetimes and in the childbearing lifetimes of those young people in this audience MCB 140 Genetics MCB140 17 01 07 1 www genelex com listed solely for reference purposes and does not imply an endorsement of any sort MCB140 17 01 07 3 The complexity of the truth stay tuned for Prof Brem s lecture 35 1 2 3 4 SNP Haplotype Linkage disequlibrium Tags informative for multiple proxies the very significant scientific problem all of this put together creates for using linkage data as a tool for generating nutrigenomics guidelines based on a particular individual s genotype at a particular SNP MCB140 17 01 07 2 Gene Name Area of Activity APOC3 Heart Health CETP Heart Health LPL Heart Health eNOS Heart Health MTHFR Heart Health Vitamin B Use MTR Heart Health Vitamin B Use MS MTRR Heart Health Vitamin B Use CBS Heart Health Vitamin B Use GSTM1 Detoxification Antioxidant Activity GSTT1 Detoxification Antioxidant Activity GSTP1 Detoxification Antioxidant Activity MnSOD Heart Health Antioxidant Activity SOD3 Heart Health Antioxidant Activity VDR Bone Health COL1A1 Bone Health IL 6 Heart Health Inflammation Bone Health TNFa Inflammation Bone Health ACE Heart Health Insulin Sensitivity PPAR2 Insulin Sensitivity Apolipoprotein C III gene APOC3 APOC3 plays an important role in lipid metabolism It inhibits the break down of triacylglycerol a lipid by the enzyme lipoprotein lipase leading to higher triglyceride levels hypertriglyceridemia The polymorphism 3175G is associated with a four fold risk of hypertriglyceridemia and is linked to an increased risk of heart attack atherosclerosis and cardiovascular disease emphasis mine fdu www genelex com listed solely for reference purposes and does not imply an endorsement of any sort MCB140 17 01 07 4 A fact and a problem Fact what we do is a function of what we know and many other things of course Problem our knowledge comes in shades of gray but actions tend to be black andwhite For now read 1 Naukkarinen et al Curr Opin Lipidol 17 3 p 285 290 not required 2 Haga and Willard Nature Reviews Cancer 206 required PubMed MCB140 17 01 07 5 MCB140 17 01 07 6 1 Risks appear to be increasing with time Breast cancer risk by age 50 among mutation carriers born before 1940 was 24 but among those born after 1940 it was 67 Five percent of 178 700 Germline mutations in BRCA1 confer a 56 80 lifetime risk for breast cancer and a 15 60 lifetime risk for ovarian cancer in women Dapic V Monteiro AN Crit Rev Eukaryot Gene Expr 2006 16 3 233 52 Physical exercise and lack of obesity in adolescence were associated with significantly delayed breast cancer onset King et al Science 2003 Oct 24 302 5645 643 6 MCB140 17 01 07 7 MCB140 17 01 07 8 The complexity of the truth part II stay tuned for Prof Brem s lecture 31 1 2 3 4 5 QTL Epistasis Environmental vs genetic variance Norm of reaction Narrow sense v broad sense heritability the very significant scientific problem all of this creates for generating treatment guidelines based on a particular individual s genotype for a cancer susceptibility locus MCB140 17 01 07 9 MCB140 17 01 07 11 www myriadgenetics com listed solely for reference purposes and does not imply an endorsement of any sort MCB140 17 01 07 10 MCB140 17 01 07 12 2 Forward PCR primer AAATTATTGAGCCTCATTTATTTTC Reverse PCR primer AAACAAAAGCTAATAATGGAGC Note the SNP shown is not 185delAG MCB140 17 01 07 13 Prophylactic bilateral mastectomy and or oopherectomy for BRCA1 2 mutation carriers A study of 139 women with deleterious BRCA1 or BRCA2 mutations who were followed at the Rotterdam Family Cancer Clinic To reduce their risk of breast cancer 76 of these women chose to undergo prophylactic bilateral mastectomy whereas the remaining 63 were followed according to a surveillance protocol consisting of a monthly breast self examination a semiannual breast examination by a health care professional and annual mammography No breast cancers were observed in the 76 women who underwent prophylactic bilateral mastectomy whereas eight were detected in the surveillance group This study supports the report by Hartmann et al that prophylactic bilateral mastectomy has an efficacy of at least 90 percent in women classified as at high risk on the basis of a family history of breast cancer Together these studies suggest that of the strategies to reduce the risk of breast cancer in high risk women prophylactic bilateral mastectomy is the most effective Two decades of research have convincingly shown that most women with breast cancer can safely be treated with breast conserving surgery instead of mastectomy Thus it is difficult to accept that prevention should be more extreme than the cure In this era of molecular medicine we strive for cancer prevention options that are more targeted and less invasive than surgical extirpation Chemoprevention for breast cancer that is as effective and safe as prophylactic bilateral mastectomy is a hope for the future A proper description of how this is done http www myriadtests com provider doc BRACAnalysis Technical Specifications pdf MCB140 17 01 07 14 People with insufficient education in genetics AND statistics and not enough time to look at the primary data Data Policy 1 Policymakers 2 Health insurance company officials 3 Health care providers i e physicians 4 Journalists who write about science and medicine for major newspapers 5 The patients themselves Andrea Eisen and Barbara Weber 2001 NEJM 345 208 MCB140 17 01 07 15 MCB140 17 01 07 16 Living With Our Genes D Hamer and P Copeland 1998 A complicated truth In the future a person who complains of depression or anxiety could have a DNA test to check the serotonin genes People with compulsive behaviour such as gambling drinking drugs or promiscuous sex would be checked for dopamine genes Eating
View Full Document
Unlocking...