Unformatted text preview:

2008 Nature Publishing Group http www nature com naturebiotechnology ARTICLES Establishment of HIV 1 resistance in CD4 T cells by genome editing using zinc finger nucleases Elena E Perez1 2 Jianbin Wang3 Jeffrey C Miller3 Yann Jouvenot3 4 Kenneth A Kim3 Olga Liu1 Nathaniel Wang3 Gary Lee3 Victor V Bartsevich3 Ya Li Lee3 Dmitry Y Guschin3 Igor Rupniewski3 Adam J Waite3 Carmine Carpenito1 Richard G Carroll1 Jordan S Orange2 Fyodor D Urnov3 Edward J Rebar3 Dale Ando3 Philip D Gregory3 James L Riley1 Michael C Holmes3 Carl H June1 Homozygosity for the naturally occurring D32 deletion in the HIV co receptor CCR5 confers resistance to HIV 1 infection We generated an HIV resistant genotype de novo using engineered zinc finger nucleases ZFNs to disrupt endogenous CCR5 Transient expression of CCR5 ZFNs permanently and specifically disrupted 50 of CCR5 alleles in a pool of primary human CD4 T cells Genetic disruption of CCR5 provided robust stable and heritable protection against HIV 1 infection in vitro and in vivo in a NOG model of HIV infection HIV 1 infected mice engrafted with ZFN modified CD4 T cells had lower viral loads and higher CD4 T cell counts than mice engrafted with wild type CD4 T cells consistent with the potential to reconstitute immune function in individuals with HIV AIDS by maintenance of an HIV resistant CD4 T cell population Thus adoptive transfer of ex vivo expanded CCR5 ZFN modified autologous CD4 T cells in HIV patients is an attractive approach for the treatment of HIV 1 infection CCR5 a seven transmembrane chemokine receptor is the major coreceptor for HIV 1 entry1 2 Since the discovery that the homozygous D32 deletion in CCR5 confers resistance to HIV 13 5 CCR5 has been intensely studied and validated as a target for HIV therapy6 7 Recently small molecule approaches that block the CCR5 HIV interaction have shown promise in clinical trials8 However the small molecule approach has resulted in the development of resistance by selection for escape mutants which continue to use CCR5 for viral entry9 These results taken together with experience from individuals heterozygous for the D32 allele point to the importance of a genetic knockout of CCR5 for phenotypic penetrance and long term resistance to infection rather than its knock down by approaches based on small molecules intrabodies antisense or RNA interference RNAi 10 15 Therefore we sought to permanently disrupt the endogenous CCR5 and thus make a phenocopy of the D32CCR5 null genotype in primary human CD4 T cells by the application of engineered ZFNs Previously we have shown that reconstituting CD4 helper T cell activity through adoptive transfer of costimulated CD4 T cells may augment natural immunity to HIV 1 infection13 Here we show that engineered ZFNs targeting human CCR5 efficiently generate a doublestrand break at a predetermined site in the CCR5 coding region upstream of the natural CCR5D32 mutation The CCR5 ZFNs promote efficient and permanent disruption of CCR5 in primary human CD4 T lymphocytes and confer robust protection against HIV 1 infection both in vitro and in an in vivo mouse model of HIV 1 infection Combining the two approaches may provide further benefit to patients with HIV 1 in future clinical trials RESULTS Design of ZFNs targeted against CCR5 CCR5 ZFN We designed and optimized a large series of ZFNs targeted to human CCR5 using a previously described approach16 For both target sites two zinc finger protein ZFP DNA binding domains each containing four zinc finger motifs recognizing a total of 24 base pairs were assembled from an archive of ZFP DNA binding modules17 18 These ZFPs were coupled to the DNA cleavage domain of the type IIS restriction enzyme FokI to produce novel ZFNs in which the location of DNA cleavage is determined by the DNA binding specificity of the engineered ZFP domains as previously shown16 17 19 Targeting a double strand break to a specific site in the genome with ZFNs has been used to disrupt permanently the genomic sequence surrounding the ZFN target site in a variety of eukaryotic organisms20 21 via imperfect repair by nonhomologous end joining NHEJ 22 23 To exploit this property of double strand break repair we elected to focus our ZFN designs upon the DNA sequence encoding the first transmembrane domain TM1 spans residues Arg31 to Asn57 of the CCR5 co receptor We reasoned that this location upstream of the 1Abramson Family Cancer Research Institute Department of Pathology and Laboratory Medicine 421 Curie Blvd Room 554 BRB II III Philadelphia Pennsylvania 19104 6160 USA 2Children s Hospital of Philadelphia Division of Allergy and Immunology Joseph Stokes Jr Research Institute 3615 Civic Center Blvd Philadelphia Pennsylvania 19104 4318 USA 3Sangamo BioSciences Inc Point Richmond Tech Center II 501 Canal Blvd Suite A100 Richmond California 94804 USA 4Present address Process Science Department Bayer Hematology Cardiology 800 Dwight Way Berkeley California 94701 USA Correspondence should be addressed to C H J cjune mail med upenn edu Received 22 April accepted 22 May published online 29 June 2008 doi 10 1038 nbt1410 808 VOLUME 26 NUMBER 7 JULY 2008 NATURE BIOTECHNOLOGY ARTICLES a 24 Chr3 p21 31 29 ZFN R Fok l ATCTTTGGTTTTGTGGGCAACATGCTGGTCATCCTCATCCTGATAAACTGCAAAAGGCTGAAGAGCATGACTGAC Ile42 Phe Gly Phe Val Gly Asn Met Leu Val Ile Leu Ile Leu55 Ile Asn Cys Lys Arg Leu Lys Ser Met Thr Asp66 TAGAAACCAAAACACCCGTTGTACGACCAGTAGGAGTAGGACTATTTGACGTTTTCCGACTTCTCGTACTGACTG Fok l b TD IL 2R 21 5 22 4 ZFN L N CCR5 c 100 Percent of Max Percent of Max 80 60 40 20 1 1 82 53 Targeted disruption GFP d 100 80 60 40 20 0 100 101 102 103 0 100 104 101 100 250 GFP 200 MFI 2008 Nature Publishing Group http www nature com naturebiotechnology ZFN binding site 150 100 50 50 0 0 NTD IL2R 215 NTD 224 D32 mutation would display substantial structural sensitivity in the context of the CCR5 protein Thus mutations introduced during repair via NHEJ would be predicted to result in truncated or nonfunctional gene products that would fail to be expressed on the cell surface in a manner analogous to the naturally occurring D32 mutant allele3 4 The lead ZFN pair binds the sequence flanking the codon for Leu55 within TM1 of human CCR5 Fig 1a and is referred to throughout as ZFN 215 A variant of these ZFNs ZFN224 was generated that incorporates engineered FokI domains that function as obligate heterodimers and thereby improve ZFN specificity The complete sequence of the ZFN pair is shown in FASTA


View Full Document

Berkeley MCELLBI 140 - Establishment of HIV-1 resistance

Documents in this Course
CLINE 5

CLINE 5

19 pages

Prions

Prions

7 pages

Cline 10

Cline 10

15 pages

Cancer

Cancer

18 pages

CLINE 11

CLINE 11

19 pages

Cancer

Cancer

71 pages

Notes

Notes

12 pages

Midterm

Midterm

7 pages

The Gene

The Gene

17 pages

Two loci

Two loci

77 pages

Load more
Loading Unlocking...
Login

Join to view Establishment of HIV-1 resistance and access 3M+ class-specific study document.

or
We will never post anything without your permission.
Don't have an account?
Sign Up

Join to view Establishment of HIV-1 resistance and access 3M+ class-specific study document.

or

By creating an account you agree to our Privacy Policy and Terms Of Use

Already a member?