Supplementary Online Information Perez, et al.Supplementary Online Information Perez, et al. Supporting Online Figures Supplementary Figure 1. Complete amino acid sequence of CCR5-targeting ZFNs Supplementary Figure 1. The complete amino acid sequences of the CCR5- targeting ZFNs. Underlined are the recognition α-helices (from position –1 to position+6).Supplementary Online Information Perez, et al. Supplementary Figure 2. The Surveyor Assay: Principle and Validation 2a. Supplementary Figure 2a: Mismatch selective endonuclease assay for measuring ZFN-mediated gene disruption. The level of ZFN-induced mutations were quantified by PCR amplification of the ZFN target region from genomic DNA, followed by denaturing and allowing wild type and mutant alleles to re-anneal together to create hetero-duplexes1. The re-annealed PCR products are then digested with the Surveyor nuclease (Transgenomic) that preferentially cuts DNA at sites of duplex distortions. Briefly, radioactive PCR (50 ul reactions) was performed (AccuPrime PCR kit (Invitrogen)) on 100ng of genomic DNA extracted from modified and control cells using the MasturePureTM DNA purification kit (Epicentre Biotechnologies) and supplemented with 5 uCi α-P32 dATP and 5 uCi α-P32 dCTP. A 292-bp fragment of the CCR5 locus encompassing the CCR5-ZFNSupplementary Online Information Perez, et al. target site was amplified for 30 cycles (95 oC - 30 sec., 60 oC - 30 sec., and 68 oC - 30 sec.) using the primers C5_Cel_160_F1: AAGATGGATTATCAAGTGTCAAGTCC; and C5_Cel_160_R1: CAAAGTCCCACTGGGCG. The PCR product was spun through a G-50 column (GE Healthcare) and 1 ul of the purified product was mixed with 1 ul of 10X annealing buffer (1X annealing buffer - 10 mM Tris, 100 mM NaCl) and water to a final volume of 10ul. The DNA was denatured and re-annealed in a PCR block using a program that allows heteroduplexes to form (95ºC - 10 min; 95ºC to 85ºC at -2ºC/s; and 85ºC to 25ºC at -0.1ºC/s). After re-annealing, 1ul of the Surveyor nuclease (Transgenomics), 1ul 10X AccuPrime PCR buffer II, and water were added to a total volume of 20 ul. The reaction was incubated at 42ºC for 20 min to digest heteroduplexes, and the cleaved products were resolved on a non-denaturing 10% TBE polyacrylamide gel (Bio-Rad). The gel was dried, exposed, and the level of ZFN-induced target gene disruption monitored by phosphorimager to determine the ratio of the uncleaved parental fragment to the two lower migrating cleaved products. The proportion of ZFN-disrupted CCR5 allleles in the original sample is calculated using the formula: (1-SQRT(Parental fraction)) *100. The assay is sensitive to single nucleotide changes and has a detection limit of ~1% ZFN-modified alleles.Supplementary Online Information Perez, et al. 2b. Supplementary Figure 2b: Validation of mismatch sensitive Surveyor nuclease assay. A 292-bp fragment of the CCR5 locus encompassing the ZFN-target site was PCR amplified from control cells and from a pool of cells with a sequence-confirmed known level of ZFN-disrupted CCR5 alleles of 88%. The PCR product from the modified cell population was serially diluted with PCR product from unmodified control cells in 2-fold increments. These mixed DNA pools were denatured, re-annealed, digested with the Surveyor nuclease, and the digested 88 44 22 11 5.52.75 1.38 0.69 0.35 074.7 74.3 49.0 47.4 26.4 26.0 13.9 14.4 6.8 6.83.6 3.5 1.9 1.8 1.0 1.2 0.6 0.9 0 0Exp.%:Obs.%:Exp.%:Obs.%:88 44 22 11 5.52.75 1.38 0.69 0.35 074.7 74.3 49.0 47.4 26.4 26.0 13.9 14.4 6.8 6.83.6 3.5 1.9 1.8 1.0 1.2 0.6 0.9 0 0Exp.%:Obs.%:Exp.%:Obs.%:Supplementary Online Information Perez, et al. products resolved and analyzed on a non-denaturing PAGE gel, as described (Supp. Fig. 2a). The observed (experimentally determined) percentage of modified alleles in the population was compared to the expected. Experimentally determined levels of CCR5-disrupted alleles accurately reflected input for mixes containing mutant alleles at between 0.69% and 44% with the square of the correlation coefficient being greater than 0.99.Supplementary Online Information Perez, et al. Supplementary Figure 3. Block in HIV entry by ZFN-induced disruption of CCR5 and rescue by expression of the CCR5 cDNA 3a. Supplementary Figure 3a. Resistance of CCR5 ZFN treated GHOST-CCR5 cell clones to HIV infection. Single cell derived clones were isolated from CCR5-ZFN transduced GHOST-CCR5 cells (Fig. 1), expanded over a period of several weeks. The CCR5 transgene was genotyped and clones possessing only ZFN-disrupted CCR5 alleles (clone 3.10a and 3.10b) were tested for resistance to HIV infection by HIV-1BAL. Clones obtained in parallel possessing an intact CCR5 100101102103104GFP levels020406080100%ofMax100101102103104GFP levels020406080100%ofMax100101102103104GFP levels100101102103104100101102103104GFP levels020406080100%ofMax020406080100020406080100%ofMax100101102103104GFP levels020406080100100101102103104GFP levels100101102103104100101102103104GFP levels0204060801000204060801000204060801000.27% inf.0.4% inf.100101102103104GFP levels020406080100%ofMax100101102103104GFP levels020406080100%ofMax100101102103104GFP levels100101102103104100101102103104GFP levels020406080100%ofMax020406080100020406080100%ofMax100101102103104GFP levels020406080100%ofMax100101102103104GFP levels020406080100%ofMax100101102103104GFP levels100101102103104100101102103104GFP levels020406080100%ofMax020406080100020406080100%ofMax57% inf.49% inf.ZFN-modifiedclonesControlclonesclone 3.10aclone 3.10bclone 3.11aclone 3.11bSupplementary Online Information Perez, et al. transgene (3.11a and 3.11b) remained HIV-1 infectable. Key: Red, Mock infection; Blue, HIV infection. 3b. Supplementary Figure 3b. CCR5 complementation recovers HIV-1 infection in CCR5-ZFN transduced GHOST-CCR5 cell clones. GHOST parental cells or ZFN-disrupted CCR5 null GHOST-CCR5 cells were transfected by Nucleofection (Amaxa) with a CCR5 expression plasmid (CCR5) or control plasmid (pcDNA). GHOST parental cells express CD4 and GFP driven by the HIV LTR. All groups were exposed to HIV-1BAL and infection assessed by GFP fluorescence 48 hours after HIV-1 challenge. For each condition the percentage of infected cells was determined and the results normalized to the parental GHOST cells transfected with CCR5. 020406080100% HIV infected cells (normalized to Parental line) pcDNA CCR5 pcDNA CCR5Ghost Parental ZFN-modified
View Full Document
Unlocking...