Unformatted text preview:

Supplementary Online Information Perez et al Supporting Online Figures Supplementary Figure 1 Complete amino acid sequence of CCR5 targeting ZFNs Supplementary Figure 1 The complete amino acid sequences of the CCR5targeting ZFNs Underlined are the recognition helices from position 1 to position 6 Supplementary Online Information Perez et al Supplementary Figure 2 The Surveyor Assay Principle and Validation 2a Supplementary Figure 2a Mismatch selective endonuclease assay for measuring ZFN mediated gene disruption The level of ZFN induced mutations were quantified by PCR amplification of the ZFN target region from genomic DNA followed by denaturing and allowing wild type and mutant alleles to re anneal together to create hetero duplexes1 The re annealed PCR products are then digested with the Surveyor nuclease Transgenomic that preferentially cuts DNA at sites of duplex distortions Briefly radioactive PCR 50 ul reactions was performed AccuPrime PCR kit Invitrogen on 100ng of genomic DNA extracted from modified and control cells using the MasturePureTM DNA purification kit Epicentre Biotechnologies and supplemented with 5 uCi P32 dATP and 5 uCi P32 dCTP A 292 bp fragment of the CCR5 locus encompassing the CCR5 ZFN Supplementary Online Information Perez et al target site was amplified for 30 cycles 95 oC 30 sec 60 oC 30 sec and 68 oC 30 sec using the AAGATGGATTATCAAGTGTCAAGTCC primers C5 Cel 160 F1 and C5 Cel 160 R1 CAAAGTCCCACTGGGCG The PCR product was spun through a G 50 column GE Healthcare and 1 ul of the purified product was mixed with 1 ul of 10X annealing buffer 1X annealing buffer 10 mM Tris 100 mM NaCl and water to a final volume of 10ul The DNA was denatured and re annealed in a PCR block using a program that allows heteroduplexes to form 95 C 10 min 95 C to 85 C at 2 C s and 85 C to 25 C at 0 1 C s After re annealing 1ul of the Surveyor nuclease Transgenomics 1ul 10X AccuPrime PCR buffer II and water were added to a total volume of 20 ul The reaction was incubated at 42 C for 20 min to digest heteroduplexes and the cleaved products were resolved on a nondenaturing 10 TBE polyacrylamide gel Bio Rad The gel was dried exposed and the level of ZFN induced target gene disruption monitored by phosphorimager to determine the ratio of the uncleaved parental fragment to the two lower migrating cleaved products The proportion of ZFN disrupted CCR5 allleles in the original sample is calculated using the formula 1 SQRT Parental fraction 100 The assay is sensitive to single nucleotide changes and has a detection limit of 1 ZFN modified alleles Supplementary Online Information Perez et al 2b Exp Obs 88 74 7 74 3 Exp 2 75 Obs 3 6 3 5 44 49 0 47 4 1 38 1 9 Supplementary Figure 2b 1 8 22 26 4 26 0 13 9 0 69 1 0 11 1 2 14 4 5 5 6 8 0 35 0 6 0 9 6 8 0 0 0 Validation of mismatch sensitive Surveyor nuclease assay A 292 bp fragment of the CCR5 locus encompassing the ZFNtarget site was PCR amplified from control cells and from a pool of cells with a sequence confirmed known level of ZFN disrupted CCR5 alleles of 88 The PCR product from the modified cell population was serially diluted with PCR product from unmodified control cells in 2 fold increments These mixed DNA pools were denatured re annealed digested with the Surveyor nuclease and the digested Supplementary Online Information Perez et al products resolved and analyzed on a non denaturing PAGE gel as described Supp Fig 2a The observed experimentally determined percentage of modified alleles in the population was compared to the expected Experimentally determined levels of CCR5 disrupted alleles accurately reflected input for mixes containing mutant alleles at between 0 69 and 44 with the square of the correlation coefficient being greater than 0 99 Supplementary Online Information Perez et al Supplementary Figure 3 Block in HIV entry by ZFN induced disruption of CCR5 and rescue by expression of the CCR5 cDNA 3a 100 c lone 3 10a 100 c lone 3 10b 0 27 inf 0 4 inf 80 80 of Max ZF N modified 60 clones 60 40 40 20 20 0 100 100 101 102 103 0 100 104 c lone 3 11a GFP levels 100 101 80 of Max of Max 104 49 inf 80 60 40 20 0 100 103 c lone 3 11b GFP levels 57 inf C ontrol c lones 102 60 40 20 101 102 103 104 GFP levels 0 100 101 102 103 104 GFP levels Supplementary Figure 3a Resistance of CCR5 ZFN treated GHOST CCR5 cell clones to HIV infection Single cell derived clones were isolated from CCR5ZFN transduced GHOST CCR5 cells Fig 1 expanded over a period of several weeks The CCR5 transgene was genotyped and clones possessing only ZFNdisrupted CCR5 alleles clone 3 10a and 3 10b were tested for resistance to HIV infection by HIV 1BAL Clones obtained in parallel possessing an intact CCR5 Supplementary Online Information Perez et al transgene 3 11a and 3 11b remained HIV 1 infectable Key Red Mock infection Blue HIV infection 3b HIV infected cells normalized to Parental line 100 80 60 40 20 0 pcDNA CCR5 Ghost Parental pcDNA CCR5 ZFN modified Clone Supplementary Figure 3b CCR5 complementation recovers HIV 1 infection in CCR5 ZFN transduced GHOST CCR5 cell clones GHOST parental cells or ZFN disrupted CCR5 null GHOST CCR5 cells were transfected by Nucleofection Amaxa with a CCR5 expression plasmid CCR5 or control plasmid pcDNA GHOST parental cells express CD4 and GFP driven by the HIV LTR All groups were exposed to HIV 1BAL and infection assessed by GFP fluorescence 48 hours after HIV 1 challenge For each condition the percentage of infected cells was determined and the results normalized to the parental GHOST cells transfected with CCR5 Supplementary Online Information Perez et al Supplementary Figure 4 Analysis of HIV tropism and viral envelope evolution in CCR5 ZFN treated HIV challenged cells 4a Supplementary Figure 4a CCR5 ZFNs confer stable heritable resistance to CCR5 tropic HIV 1 infection PM1 cells were mock transfected or transfected with plasmids encoding the CCR5 ZFNs R5 or a control glucocorticoid receptor GR ZFN pair as described in manuscript Fig 2 These cell populations were challenged with HIV 1BAL and on day 59 post infection a portion of each sample was mixed with parental non transfected PM1 cells and re infected with either CXCR4 tropic HIV 1BK132 or CCR5 tropic HIV 1BAL These re infected cultures were followed over time and analyzed for CCR5 gene disruption frequency on day 21 post reinfection day 80 post initial infection Supplementary Online Information Perez et al 4b Day 56 Supernatants Day 3 Supernatants X4 GHOST X4 GHOST 100


View Full Document

Berkeley MCELLBI 140 - Genome Editing

Documents in this Course
CLINE 5

CLINE 5

19 pages

Prions

Prions

7 pages

Cline 10

Cline 10

15 pages

Cancer

Cancer

18 pages

CLINE 11

CLINE 11

19 pages

Cancer

Cancer

71 pages

Notes

Notes

12 pages

Midterm

Midterm

7 pages

The Gene

The Gene

17 pages

Two loci

Two loci

77 pages

Load more
Loading Unlocking...
Login

Join to view Genome Editing and access 3M+ class-specific study document.

or
We will never post anything without your permission.
Don't have an account?
Sign Up

Join to view Genome Editing and access 3M+ class-specific study document.

or

By creating an account you agree to our Privacy Policy and Terms Of Use

Already a member?