www genelex com listed solely for reference purposes and does not imply an endorsement of any sort MCB 140 Genetics MCB140 17 01 07 3 MCB140 17 01 07 1 Heart Health Heart Health Heart Health Heart Health Heart Health Vitamin B Use Heart Health Vitamin B Use Heart Health Vitamin B Use Heart Health Vitamin B Use Detoxification Antioxidant Activity Detoxification Antioxidant Activity Detoxification Antioxidant Activity Heart Health Antioxidant Activity Heart Health Antioxidant Activity Bone Health Bone Health Heart Health Inflammation Bone Health Inflammation Bone Health Heart Health Insulin Sensitivity Insulin Sensitivity CETP LPL eNOS MTHFR MTR MS MTRR CBS GSTM1 GSTT1 GSTP1 MnSOD SOD3 VDR COL1A1 IL 6 TNFa ACE PPAR2 MCB140 17 01 07 4 APOC3 plays an important role in lipid metabolism It inhibits the break down of triacylglycerol a lipid by the enzyme lipoprotein lipase leading to higher triglyceride levels hypertriglyceridemia The polymorphism 3175G is associated with a four fold risk of hypertriglyceridemia and is linked to an increased risk of heart attack atherosclerosis and cardiovascular disease emphasis mine fdu Apolipoprotein C III gene APOC3 www genelex com listed solely for reference purposes and does not imply an endorsement of any sort Area of Activity Gene Name APOC3 MCB140 17 01 07 2 I was honored to be president at the time when the International Consortium of Scientists finished the sequencing of the human genome something which has already yielded the two major variances that are high predictors of breast cancer something that is leading us very close to unlocking the genetic strains that cause Parkinson s and Alzheimer s And quite soon young women will come home from the hospital with their newborn babies in countries with good health systems with little gene cards that will say Here are your child s strengths and weaknesses and if you do the following ten things your baby has a life expectancy of 93 years This is going to happen in the lifetimes and in the childbearing lifetimes of those young people in this audience President Clinton Comes to Cal Jan 29 2002 1 MCB140 17 01 07 7 Crit Rev Eukaryot Gene Expr 2006 16 3 233 52 Dapic V Monteiro AN Germline mutations in BRCA1 confer a 56 80 lifetime risk for breast cancer and a 15 60 lifetime risk for ovarian cancer in women Five percent of 178 700 PubMed MCB140 17 01 07 5 the very significant scientific problem all of this put together creates for using linkage data as a tool for generating nutrigenomics guidelines based on a particular individual s genotype at a particular SNP For now read 1 Naukkarinen et al Curr Opin Lipidol 17 3 p 285 290 not required 2 Haga and Willard Nature Reviews Cancer 206 required SNP Haplotype Linkage disequlibrium Tags informative for multiple proxies 1 2 3 4 stay tuned for Prof Brem s lecture 35 The complexity of the truth MCB140 17 01 07 8 King et al Science 2003 Oct 24 302 5645 643 6 Physical exercise and lack of obesity in adolescence were associated with significantly delayed breast cancer onset Risks appear to be increasing with time Breast cancer risk by age 50 among mutation carriers born before 1940 was 24 but among those born after 1940 it was 67 MCB140 17 01 07 6 Problem our knowledge comes in shades of gray but actions tend to be black andwhite Fact what we do is a function of what we know and many other things of course A fact and a problem 2 QTL Epistasis Environmental vs genetic variance Norm of reaction Narrow sense v broad sense heritability MCB140 17 01 07 11 MCB140 17 01 07 9 the very significant scientific problem all of this creates for generating treatment guidelines based on a particular individual s genotype for a cancer susceptibility locus 1 2 3 4 5 stay tuned for Prof Brem s lecture 31 The complexity of the truth part II www myriadgenetics com listed solely for reference purposes and does not imply an endorsement of any sort MCB140 17 01 07 12 MCB140 17 01 07 10 3 MCB140 17 01 07 13 Andrea Eisen and Barbara Weber 2001 NEJM 345 208 MCB140 17 01 07 15 A study of 139 women with deleterious BRCA1 or BRCA2 mutations who were followed at the Rotterdam Family Cancer Clinic To reduce their risk of breast cancer 76 of these women chose to undergo prophylactic bilateral mastectomy whereas the remaining 63 were followed according to a surveillance protocol consisting of a monthly breast self examination a semiannual breast examination by a health care professional and annual mammography No breast cancers were observed in the 76 women who underwent prophylactic bilateral mastectomy whereas eight were detected in the surveillance group This study supports the report by Hartmann et al that prophylactic bilateral mastectomy has an efficacy of at least 90 percent in women classified as at high risk on the basis of a family history of breast cancer Together these studies suggest that of the strategies to reduce the risk of breast cancer in high risk women prophylactic bilateral mastectomy is the most effective Two decades of research have convincingly shown that most women with breast cancer can safely be treated with breast conserving surgery instead of mastectomy Thus it is difficult to accept that prevention should be more extreme than the cure In this era of molecular medicine we strive for cancer prevention options that are more targeted and less invasive than surgical extirpation Chemoprevention for breast cancer that is as effective and safe as prophylactic bilateral mastectomy is a hope for the future Prophylactic bilateral mastectomy and or oopherectomy for BRCA1 2 mutation carriers Note the SNP shown is not 185delAG Forward PCR primer AAATTATTGAGCCTCATTTATTTTC Reverse PCR primer AAACAAAAGCTAATAATGGAGC MCB140 17 01 07 14 Data Policymakers Health insurance company officials Health care providers i e physicians Journalists who write about science and medicine for major newspapers The patients themselves 1 2 3 4 5 MCB140 17 01 07 16 Policy People with insufficient education in genetics AND statistics and not enough time to look at the primary data A proper description of how this is done http www myriadtests com provider doc BRACAnalysis Technical Specifications pdf 4 MCB140 17 01 07 17 New York Times Nov 20 2003 p C8 MCB140 17 01 07 19 If you belong to a certain extended family in Seattle you re probably an entrepreneur It seems to be about the only career many of the members ever considered It s in our blood said Brian Jacobsen president of Madison Park Greetings a
View Full Document