MCB 140 – General GeneticsCase 22-2007 — A Woman with a Family History of Gastric and Breast CancerSlide 3Gastric cancerSlide 5CDH1 – E-cadherinA particular exon of CDH1Slide 8This woman’s genotype for CDH1Management and solutionThe surgerySlide 12Words from the patient herselfGregor Mendel (1822-1884)Mendel’s garden in BrnoSlide 16Slide 17Slide 18“Most ignorance is willful” (Bill Watterson)The complexity of the truth (stay tuned for Prof. Brem’s lecture)A fact, and a problemPeople with insufficient education in genetics AND statistics and not enough time to look at the primary dataCancelled health insurance?“Gene Variant Is Linked to Common Type of Stroke” NYT 1/9/07Gene for starting businessesSlide 26Gene for metaphorsThe God GeneThe problemOntology vs. epistemologyWhat MCB140 is NOTWhat to do so as to do wellPart I – “classical genetics”Part II: methods in experimental genetics (Prof. Garriga)Section III: genomics and quantitative genetics (Prof. Brem)Slide 36Observable phenomena, explainable and notSlide 38Heredity: “blending inheritance”?Phenomenon explanation of mechanismJust So Stories (R. Kipling)“Accusers All; Going Negative: When It Works” New York Times 8-22-04“Accusers All; Going Negative: When It Works” New York Times 8-22-04 ctdScientific methodProblems 2.2 and 2.3 – required (write out the answer in essay form)Before MendelThe significance of the “reverse cross”Slide 48Slide 49Slide 50Slide 51Word of the day: heuristic“Grrrrr”Joseph Kölreuter (1761)1761 - 1900Mendel’s most famous wordsNewton, Darwin, Mendel, EinsteinScientific reductionismWhy?Astonishing foresightWords to live byA universally applicable statementWhat plant to pickUseful piece of experimental guidance for a geneticistSlide 65hh plant and its non-Mendelian offspring“Startling Scientists, Plant Fixes Its Flawed Gene” – NYT 3/23/06Slide 68Slide 69I’m sorry, whose razor?Slide 71Why the pea?Slide 73The garden pea (Pisum sativum) – a powerful “model system” for genetic experimentationNext timeMCB140, 27-08-07 1MCB 140 – General GeneticsMCB140, 27-08-07 2Case 22-2007 — A Woman with a Family History of Gastric and Breast CancerA 38-year-old woman was seen in the Gastrointestinal Cancer Genetics Clinic of this hospital because of a family history of breast and gastric cancer. Approximately 15 months earlier, mild chronic gastrointestinal symptoms, including dyspepsia, heartburn, and midabdominal discomfort, increased in severity and began to occur daily. The symptoms did not resolve with antacid therapy. She had lost approximately 2.3 kg (5 lb) during this time, which she attributed to the stress of caring for her maternal aunt, who was dying of gastric cancer. Seven months before admission, an endoscopic examination of the upper gastrointestinal tract, performed at another hospital, was normal. New England Journal of Medicine, 357:283-291 (July 19, 2007)MCB140, 27-08-07 3New England Journal of Medicine, 357:283-291 (July 19, 2007)MCB140, 27-08-07 4Gastric cancerGastric cancer is the second leading cause of cancer deaths worldwide. There are two major histologic subtypes of gastric cancer: intestinal and diffuse. The intestinal subtype is associated with environmental risk factors including H. pylori infection, smoking, and diets high in salted and cured foods … Only 1 to 3% of the cases are probably attributable to a high-penetrance genetic syndrome. Five entities confer a risk of gastric cancer (Table 1), all of which are inherited in an autosomal dominant manner. New England Journal of Medicine, 357:283-291 (July 19, 2007)MCB140, 27-08-07 5New England Journal of Medicine, 357:283-291 (July 19, 2007)MCB140, 27-08-07 6CDH1 – E-cadherinMCB140, 27-08-07 7A particular exon of CDH1>hg18_dna range=chr16:67401613-67401713 GCTGTGTCATCCAACGGGAATGCAGTTGAGGATCCAATGGAGATTTTGAT CACGGTAACCGATCAGAATGACAACAAGCCCGAATTCACCCAGGAGGTCT “Polymerase chain reaction” – PCR – “PCR primers” -- $16MCB140, 27-08-07 8A proper description of how this is done:http://www.myriadtests.com/provider/doc/BRACAnalysis-Technical-Specifications.pdfMCB140, 27-08-07 9This woman’s genotype for CDH1When the patient's maternal aunt received a diagnosis of gastric cancer, she was offered tests to detect the CDH1 gene. These tests were performed … and showed an R732Q mutation resulting in a substitution of glutamine for arginine at amino acid 732. This information was known to the patient and to us at the time of her evaluation in our clinic. We offered this patient germ-line testing for the R732Q mutation that had previously been identified in the family; these tests showed the same mutation in our patient. Mutations in E-cadherin, the protein encoded by the gene CDH1, result in a loss of normal adhesion and an increase in cellular migration and invasion.New England Journal of Medicine, 357:283-291 (July 19, 2007)MCB140, 27-08-07 10Management and solutionThere are two major options for screening for gastric cancer in this patient: surveillance upper endoscopy with random biopsies and prophylactic gastrectomy. In this 38-year-old patient with a CDH1 mutation, we recommended prophylactic gastrectomy. If she declined, upper endoscopy every 6 months with random biopsies would have been recommended. She was initially hesitant to proceed with gastrectomy, so an upper endoscopy with methylene blue stain was performed. The examination was normal, and pathological examination of random biopsy specimens detected no cancer. After additional consultation with the surgeon, the patient elected to have a prophylactic gastrectomy. New England Journal of Medicine, 357:283-291 (July 19, 2007)MCB140, 27-08-07 11The surgeryDr. Sam Yoon: This patient was extremely well informed about the risks and benefits of prophylactic surgery through discussions with her physicians, nutritionist, and support groups. I performed a total gastrectomy and Roux-en-Y reconstruction consisting of a jejunal pouch and hand-sewn esophagojejunostomy. A study with diatrizoate meglumine and diatrizoate sodium on the fifth postoperative day showed no evidence of anastomotic leak, and she started a clear liquid diet. She was discharged on the eighth postoperative day, tolerating a soft solid diet. Five months after the operation, her weight had stabilized at 52 kg (115 lb) (decreased from 58 kg [128 lb]), and she was eating six to eight meals per day. New England Journal of Medicine,
View Full Document
Unlocking...