MCB 140 General Genetics MCB140 27 08 07 1 Case 22 2007 A Woman with a Family History of Gastric and Breast Cancer A 38 year old woman was seen in the Gastrointestinal Cancer Genetics Clinic of this hospital because of a family history of breast and gastric cancer Approximately 15 months earlier mild chronic gastrointestinal symptoms including dyspepsia heartburn and midabdominal discomfort increased in severity and began to occur daily The symptoms did not resolve with antacid therapy She had lost approximately 2 3 kg 5 lb during this time which she attributed to the stress of caring for her maternal aunt who was dying of gastric cancer Seven months before admission an endoscopic examination of the upper gastrointestinal tract performed at another hospital was normal New England Journal of Medicine 357 283 291 July 19 2007 MCB140 27 08 07 2 New England Journal of Medicine 357 283 291 July 19 2007 MCB140 27 08 07 3 Gastric cancer Gastric cancer is the second leading cause of cancer deaths worldwide There are two major histologic subtypes of gastric cancer intestinal and diffuse The intestinal subtype is associated with environmental risk factors including H pylori infection smoking and diets high in salted and cured foods Only 1 to 3 of the cases are probably attributable to a high penetrance genetic syndrome Five entities confer a risk of gastric cancer Table 1 all of which are inherited in an autosomal dominant manner New England Journal of Medicine 357 283 291 July 19 2007 MCB140 27 08 07 4 New England Journal of Medicine 357 283 291 July 19 2007 MCB140 27 08 07 5 CDH1 E cadherin MCB140 27 08 07 6 A particular exon of CDH1 hg18 dna range chr16 67401613 67401713 GCTGTGTCATCCAACGGGAATGCAGTTGAGGATCCAATGGAGATTTTGAT CACGGTAACCGATCAGAATGACAACAAGCCCGAATTCACCCAGGAGGTCT Polymerase chain reaction PCR PCR primers 16 MCB140 27 08 07 7 A proper description of how this is done http www myriadtests com provider doc BRACAnalysis Technical Specifications pdf MCB140 27 08 07 8 This woman s genotype for CDH1 When the patient s maternal aunt received a diagnosis of gastric cancer she was offered tests to detect the CDH1 gene These tests were performed and showed an R732Q mutation resulting in a substitution of glutamine for arginine at amino acid 732 This information was known to the patient and to us at the time of her evaluation in our clinic We offered this patient germ line testing for the R732Q mutation that had previously been identified in the family these tests showed the same mutation in our patient Mutations in E cadherin the protein encoded by the gene CDH1 result in a loss of normal adhesion and an increase in cellular migration and invasion New England Journal of Medicine 357 283 291 July 19 2007 MCB140 27 08 07 9 Management and solution There are two major options for screening for gastric cancer in this patient surveillance upper endoscopy with random biopsies and prophylactic gastrectomy In this 38 year old patient with a CDH1 mutation we recommended prophylactic gastrectomy If she declined upper endoscopy every 6 months with random biopsies would have been recommended She was initially hesitant to proceed with gastrectomy so an upper endoscopy with methylene blue stain was performed The examination was normal and pathological examination of random biopsy specimens detected no cancer After additional consultation with the surgeon the patient elected to have a prophylactic gastrectomy New England Journal of Medicine 357 283 291 July 19 2007 MCB140 27 08 07 10 The surgery Dr Sam Yoon This patient was extremely well informed about the risks and benefits of prophylactic surgery through discussions with her physicians nutritionist and support groups I performed a total gastrectomy and Roux en Y reconstruction consisting of a jejunal pouch and hand sewn esophagojejunostomy A study with diatrizoate meglumine and diatrizoate sodium on the fifth postoperative day showed no evidence of anastomotic leak and she started a clear liquid diet She was discharged on the eighth postoperative day tolerating a soft solid diet Five months after the operation her weight had stabilized at 52 kg 115 lb decreased from 58 kg 128 lb and she was eating six to eight meals per day New England Journal of Medicine 357 283 291 July 19 2007 MCB140 27 08 07 11 New England Journal of Medicine 357 283 291 July 19 2007 MCB140 27 08 07 12 Words from the patient herself I always feared I would die young of stomach cancer as my mother had and the fear worsened after my three children were born Learning that my aunt had the CDH1 mutation and helping care for her as she died I became increasingly anxious When I learned that I had the mutation I was shocked to know that I was at great risk for the development of cancer yet relieved I could do something about it but it would be a radical choice My husband researched the issue and helped us both realize that gastrectomy was the best option It helped me tremendously to talk with others who had had this operation and a support group for families with this diagnosis is available http health groups yahoo com group HDGC I learned that recovery would be very difficult but that I would be okay My husband and I were honest with our children 1 3 and 5 years of age and reading a children s book with them helped the older ones understand 34 It was a very difficult recovery but a year later I feel almost normal with even a 5 lb weight gain When I consider that each of our children has a 50 chance of having this mutation I know they at least have the same option I did and I hope to show them what a livable solution it is MCB140 27 08 07 13 Gregor Mendel 1822 1884 MCB140 27 08 07 14 Mendel s garden in Brno MCB140 27 08 07 15 President Clinton Comes to Cal Jan 29 2002 I was honored to be president at the time when the International Consortium of Scientists finished the sequencing of the human genome something which has already yielded the two major variances that are high predictors of breast cancer something that is leading us very close to unlocking the genetic strains that cause Parkinson s and Alzheimer s And quite soon young women will come home from the hospital with their newborn babies in countries with good health systems with little gene cards that will say Here are your child s strengths and weaknesses and if you do the following ten things your baby has a life expectancy of 93 years This is going to happen in the lifetimes and in the childbearing lifetimes of those young
View Full Document
Unlocking...