Supplementary information for DeKelver et al Functional Genomics Proteomics and Regulatory DNA Analysis in Isogenic Settings Using Zinc Finger Nuclease Driven Transgenesis Into a Safe Harbor Locus in the Human Genome Calculation of transgenic haplotype frequency in cell pools enriched for genome edited chromatids Even at low eg 20 22 PCR cycle numbers chromatids carrying transgenes at AAVS1 will amplify at a reduced efficiency relative to wild type chromatids As a result their frequency will be underestimated The extent of this amplification bias will differ between loci and for the same locus between transgenes To allow the accurate measurement of such a bias for the experiment where FACS was used to enrich for cells carrying added transgenes supp fig 7 we did the following a single cell derived clone biallelic for the transgene of interest was isolated expanded and genomic DNA purified Equal masses of that genomic DNA and that from wild type K562 cells were mixed and amplified using body labelled PCR see Materials and Methods The transgenic band signal in this experiment was 17 that of wild type EM and RD data not shown This provided the normalization factor to transition from the observed ratio of transgenic to wild type chromatids in the FACSenriched pool to the actual one Evaluating Genome Wide Consequences of ZFN Driven AAVS1 Editing The goal of our effort is was to establish an approach for transgenesis in isogenic settings for human somatic cell genetics While the ZFN recognition site is unique in the human genome it was important to investigate whether ZFN driven transgene addition to the AAVS1 locus is associated with an unacceptably high frequency of undesired effects on the genotype of the target cell 1 Three different assays were used to investigate this issue i nucleus wide measurement of DSB induction in the cell Miller et al 2007 ii global analysis of donor DNA random integration frequency with and without ZFNs in transformed cells Moehle et al 2007 iii Southern blotting of single cell derived clones Data from all three assays shown below argue that undesired effects if they do occur do so at a frequency acceptably low for somatic cell genetic experiments both in transformed and in hES cells DSB induction was measured genome wide using via a hallmark of DSB repair the assembly of a focus of phosphorylated histone variant H2A X at the repair site Paull et al 2000 Cells were transiently transfected with ZFNs or treated with the DSB inducing drug etoposide H2A X foci that accumulate in these cells were quantitated by immunostaining and FACS based measurement Miller et al 2007 This assay does not measure the absolute number of DSBs per nucleus instead it allows a comparison of the AAVS1 ZFNs to those that target the IL2R locus and characterized earlier for genome wide editing specificity Miller et al 2007 Urnov et al 2005 The two ZFN pairs showed essentially identical levels of H2A X staining above the ZFN untreated samples supp fig 3b in this assay the AAVS1 ZFNs were 2 5x more active in target locus editing than the IL2R ZFNs supp fig 3a compare lanes 2 and 4 Treatment with etoposide resulted in an increase in H2A X signal supp fig 3b right sample Next to determine whether expression of the AAVS1 specific ZFNs would increase the rate of random integration of the donor DNA into the genome a plasmid donor DNA was used that carries an autonomous expression cassette for a cell surface marker NGFR outside the donor homology arms supp fig 3c Random integration of this donor plasmid yields NGFR positive cells in fact addition of etoposide which induces random double 2 strand breaks led to a dose dependent increase in the number of NGFR positive cells supp fig 3d No increase in the random donor plasmid integration rate in ZFN and donortreated was observed as compated to the level seen in control cells treated with the donor DNA only supp fig 3d In a separate study Orlando et al 2010 we show that gene addition to AAVS1 locus can occur using linear DNA fragments carrying short 50 100 bp homology arms Of relevance to the issue of potential ZFN driven donor misintegration in that study we fail to observe any detectable misintegration of such linear fragments into potential ZFN off target sites in the genome Orlando et al 2010 Here to address this issue in a different cell system we made use of donor constructs that carry promotorless selectable markers These were electroporated into hES cells along with ZFNs drug resistant clones selected and the AAVS1 locus genotyped using a probe that would also reveal a donor construct that integrated elsewhere in the genome as well as the AAVS1 locus No misintegration was observed in over 90 of the clones that carried the donor specified transgene at the AAVS1 locus supp fig 8 It is formally possible that some random donor integrations are in fact directed by offtarget cleavage by the ZFNs but if that is the case this is an infrequent event supp fig 8 3 Supplementary movie M1 See text and Fig 3 for details The metaphase anaphase transition shown in Fig 3 occurs 22 seconds into the movie Supplementary figure 1 Donor only sample Fig 1c lane 1 ZFN donor sample Fig 1c lane 2 Phosphorimager traces of lane 1 top panel donor plasmid only and lane 2 bottom panel ZFN expression construct and donor plasmid from Fig 1c The bottom of the autoradiograph is on the right of each image the major peak is the wild type chromatid The edited chromatid is visualized as an additional peak in the lower panel 4 Supplementary figure 2 Upstream chromosome donor homology arm boundary chromosome donor CCCAGGCAGGTCCTGCTTTCTCTGACCTGC GGGTCCGTCCAGGACGAAAGAGACTGGACG Chromatograms from single cell derived clones ctd on next page 5 Supplementary figure 2 ctd Downstream chromosome donor homology arm boundary donor chromosome TGGCTCTGCTCTTCAGACTGAGCCCCGTTC ACCGAGACGAGAAGTCTGACTCGGGGCAAG Chromatograms from single cell derived clones Gene addition to AAVS1 occurs via a homology directed process K562 cells were transfected with ZFNs directed against AAVS1 and GFP carrying donor constructs GFPpositive single cell derived clones were isolated and genotyped at the AAVS1 locus Three clones that lacked a wild type size chromatid KJP data not shown ie presumably diallelic for a gene addition event were chosen at random The PCR product was cloned without gel purification ie to ensure against bias for a product of a particular size and sequenced with primers that anneal to the vector
View Full Document
Unlocking...