1 Supplementary information for DeKelver et al., “Functional Genomics, Proteomics, and Regulatory DNA Analysis in Isogenic Settings Using Zinc Finger Nuclease-Driven Transgenesis Into a Safe Harbor Locus in the Human Genome” Calculation of transgenic haplotype frequency in cell pools enriched for genome-edited chromatids Even at low (eg, 20-22) PCR cycle numbers, chromatids carrying transgenes at AAVS1 will amplify at a reduced efficiency relative to wild-type chromatids. As a result, their frequency will be underestimated. The extent of this amplification bias will differ between loci, and for the same locus, between transgenes. To allow the accurate measurement of such a bias for the experiment where FACS was used to enrich for cells carrying added transgenes (supp. fig. 7),we did the following: a single-cell derived clone biallelic for the transgene of interest was isolated, expanded, and genomic DNA purified. Equal masses of that genomic DNA and that from wild-type K562 cells were mixed, and amplified using body-labelled PCR (see Materials and Methods). The transgenic band signal in this experiment was 17% that of wild-type (EM and RD, data not shown). This provided the “normalization factor” to transition from the observed ratio of transgenic to wild-type chromatids in the FACS-enriched pool to the actual one. Evaluating Genome-Wide Consequences of ZFN-Driven AAVS1 Editing The goal of our effort is was to establish an approach for transgenesis in isogenic settings for human somatic cell genetics. While the ZFN recognition site is unique in the human genome, it was important to investigate whether ZFN-driven transgene addition to the AAVS1 locus is associated with an unacceptably high frequency of undesired effects on the genotype of the target cell.2Three different assays were used to investigate this issue: (i) nucleus-wide measurement of DSB induction in the cell (Miller et al. 2007); (ii) global analysis of donor DNA random integration frequency with and without ZFNs in transformed cells (Moehle et al. 2007); (iii) Southern blotting of single-cell-derived clones. Data from all three assays, shown below, argue that undesired effects, if they do occur, do so at a frequency acceptably low for somatic cell genetic experiments both in transformed and in hES cells. DSB induction was measured genome-wide using via a hallmark of DSB repair: the assembly of a focus of phosphorylated histone variant H2A.X at the repair site (Paull et al. 2000). Cells were transiently transfected with ZFNs or treated with the DSB-inducing drug etoposide. H2A.X foci that accumulate in these cells were quantitated by immunostaining and FACS-based measurement (Miller et al. 2007). This assay does not measure the absolute number of DSBs per nucleus; instead, it allows a comparison of the AAVS1 ZFNs to those that target the IL2Rγ locus, and characterized earlier for genome-wide editing specificity (Miller et al. 2007; Urnov et al. 2005). The two ZFN pairs showed essentially identical levels of H2A.X staining above the ZFN-untreated samples (supp fig. 3b); in this assay, the AAVS1 ZFNs were 2.5x more active in target locus editing than the IL2Rγ ZFNs (supp fig. 3a, compare lanes 2 and 4). Treatment with etoposide resulted in an increase in H2A.X signal (supp. fig. 3b, right sample). Next, to determine whether expression of the AAVS1-specific ZFNs would increase the rate of random integration of the donor DNA into the genome, a plasmid donor DNA was used that carries an autonomous expression cassette for a cell surface marker (NGFR) outside the donor homology arms (supp fig 3c). Random integration of this donor plasmid yields NGFR-positive cells; in fact, addition of etoposide – which induces random double-3strand breaks – led to a dose-dependent increase in the number of NGFR-positive cells (supp fig. 3d). No increase in the random donor plasmid integration rate in ZFN- and donor-treated was observed as compated to the level seen in control cells treated with the donor DNA only (supp fig. 3d). In a separate study (Orlando et al. 2010), we show that gene addition to AAVS1 locus can occur using linear DNA fragments carrying short (50-100 bp) homology arms. Of relevance to the issue of potential ZFN-driven donor misintegration, in that study we fail to observe any detectable misintegration of such linear fragments into potential ZFN off-target sites in the genome (Orlando et al. 2010). Here, to address this issue in a different cell system, we made use of donor constructs that carry promotorless selectable markers. These were electroporated into hES cells along with ZFNs, drug-resistant clones selected, and the AAVS1 locus genotyped using a probe that would also reveal a donor construct that integrated elsewhere in the genome as well as the AAVS1 locus. No misintegration was observed in over 90% of the clones that carried the donor-specified transgene at the AAVS1 locus (supp. fig. 8). It is formally possible that some random donor integrations are, in fact, directed by off-target cleavage by the ZFNs, but if that is the case, this is an infrequent event (supp. fig. 8).4Supplementary movie M1 See text and Fig 3 for details. The metaphase-anaphase transition shown in Fig 3 occurs ~22 seconds into the movie. Supplementary figure 1 “Donor only” sample, Fig 1c, lane 1 “ZFN + donor” sample, Fig. 1c, lane 2 Phosphorimager traces of lane 1 (top panel – donor plasmid only) and lane 2 (bottom panel – ZFN expression construct and donor plasmid) from Fig. 1c. The bottom of the autoradiograph is on the right of each image; the major peak is the wild-type chromatid. The edited chromatid is visualized as an additional peak in the lower panel.5Supplementary figure 2 Upstream chromosome/donor homology arm boundary: chromosome donor ~~~~~~~~~~~~~~~~~ CCCAGGCAGGTCCTGCTTTCTCTGACCTGC GGGTCCGTCCAGGACGAAAGAGACTGGACG Chromatograms from single-cell-derived clones: [ctd on next page]6Supplementary figure 2 (ctd) Downstream chromosome/donor homology arm boundary: donor chromosome ~~~~~~~~~~~~~~~~~ TGGCTCTGCTCTTCAGACTGAGCCCCGTTC ACCGAGACGAGAAGTCTGACTCGGGGCAAG Chromatograms from single-cell-derived clones: Gene addition to AAVS1 occurs via a homology-directed process. K562 cells were transfected with ZFNs directed against AAVS1 and GFP-carrying donor constructs. GFP-positive single-cell-derived clones were isolated and genotyped
View Full Document
Unlocking...