BIOL 1107 1nd Edition Lecture 21Outline of Last Lecture I. DNA ReplicationII. Replication ForkIII. Chromosome endsOutline of Current Lecture I. Central DogmaII. Three Stages of TranscriptionIII. Prokaryote vs. Eukaryote IV. MutantsCurrent LectureI. Central Dogma- What’s the central dogma? It’s how DNA makes protein- Gene expression is not species specifico Green fluorescent protein (GFP) gene from jelly fish- Transcription and translation video -> Mathew Cook (YouTube) II. Three Stages of Transcription- (1) Initiation (2) Elongation (3) Termination - Promoter- starting region o Region that is AT rich (As and Ts already have two hydrogen bonds, easier to separate)- Transcription factors- several of these bind to DNA- There are three RNA polymerase molecules- RNA polymerase II- comes to DNA molecule- Template strand- strand that gets copied; the other strand is called the non-template strand - Choice of strand is importantThese notes represent a detailed interpretation of the professor’s lecture. GradeBuddy is best used as a supplement to your own notes, not as a substitute.- Termination- don’t want RNA polymerase copying everything in our cell; waste of energy III. Prokaryote vs. Eukaryote- Eukaryotes process RNA vs. bacteria just jump on it and it’s done- Structure of mature eukaryotic mRNA- Non-coding regions- What’s an exon? A segment of a DNA or RNA molecule containing information coding for a protein or peptide sequence.- Pyruvate kinase- regulatory enzyme; regulation, substrate binding, ADP binding, domains tend to fold separately o An enzyme involved in glycolysis. It catalyzes the transfer of a phosphate group from phosphoenolpyruvate (PEP) to ADP, yielding one molecule of pyruvate and one molecule of ATP.- Alternative splicing- 30% of human genes can be spliced in different ways - Translation- main power house? Ribosome- Structure of ribosome: - Based in DNA/RNA from triplet code- Anticodon binds to codono Anticodon (AAG) binds to codon (UUC)o What amino acid is added for this particular one? PhenylalanineQ: This RNA sequence was isolated from the beginning of a gene. How many amino acids does this fragment probably code for?5’ GCGAUGCCUCAUCGAUAACCG3’AUG- start codonUAA- stop codonA: 4 amino acids- Start codon- AUG (remember)- Stop codons- UGA, UAA, UAG - Keep these in mind! Codon table will be given on testIV. Mutants - Mutation- DNA damage- What causes mutations? Replication errors, cell metabolism, ionizing radiation, UV radiation, chemicals - Result? DNA repair, apoptosis, gene expression, cell division- How it occurs?- Not all mutations are bad…o For example: genetic diversity (hair color, eyes, etc), sickle cells (if you have only one copy) -> sickle cell protects you against malaria
View Full Document
Unlocking...