BIOL 1107 1nd Edition Lecture 21 Outline of Last Lecture I DNA Replication II Replication Fork III Chromosome ends Outline of Current Lecture I Central Dogma II Three Stages of Transcription III Prokaryote vs Eukaryote IV Mutants Current Lecture I Central Dogma What s the central dogma It s how DNA makes protein II Gene expression is not species specific o Green fluorescent protein GFP gene from jelly fish Transcription and translation video Mathew Cook YouTube Three Stages of Transcription 1 Initiation 2 Elongation 3 Termination Promoter starting region o Region that is AT rich As and Ts already have two hydrogen bonds easier to separate Transcription factors several of these bind to DNA There are three RNA polymerase molecules RNA polymerase II comes to DNA molecule Template strand strand that gets copied the other strand is called the nontemplate strand Choice of strand is important These notes represent a detailed interpretation of the professor s lecture GradeBuddy is best used as a supplement to your own notes not as a substitute III Termination don t want RNA polymerase copying everything in our cell waste of energy Prokaryote vs Eukaryote Eukaryotes process RNA vs bacteria just jump on it and it s done Structure of mature eukaryotic mRNA Non coding regions What s an exon A segment of a DNA or RNA molecule containing information coding for a protein or peptide sequence Pyruvate kinase regulatory enzyme regulation substrate binding ADP binding domains tend to fold separately o An enzyme involved in glycolysis It catalyzes the transfer of a phosphate group from phosphoenolpyruvate PEP to ADP yielding one molecule of pyruvate and one molecule of ATP Alternative splicing 30 of human genes can be spliced in different ways Translation main power house Ribosome Structure of ribosome Based in DNA RNA from triplet code Anticodon binds to codon o Anticodon AAG binds to codon UUC o What amino acid is added for this particular one Phenylalanine Q This RNA sequence was isolated from the beginning of a gene How many amino acids does this fragment probably code for 5 GCGAUGCCUCAUCGAUAACCG3 AUG start codon UAA stop codon A 4 amino acids IV Start codon AUG remember Stop codons UGA UAA UAG Keep these in mind Codon table will be given on test Mutants Mutation DNA damage What causes mutations Replication errors cell metabolism ionizing radiation UV radiation chemicals Result DNA repair apoptosis gene expression cell division How it occurs Not all mutations are bad o For example genetic diversity hair color eyes etc sickle cells if you have only one copy sickle cell protects you against malaria sometimes
View Full Document
Unlocking...