Test Bank forChapter 18: Gene Mutations and DNA RepairShort-Answer QuestionsCATGGATATCG ATAGATCGTTGTACAGTCCTGAGGTest Bank for Chapter 18: Gene Mutations and DNA RepairMultiple-Choice Questions1. The type of mutation that reverses the effects of a frameshift mutation without changing the frameshift and occurs with the same gene as the frameshift is called a(n)a. intergenic suppressor mutationb. nonsense mutationc. missense mutationd. intragenic suppressor mutatione. silent mutationAnswer: dSection 18.1Comprehension Question2. How do germ-line mutations differ from somatic mutations? a. Germ-line mutations involve small changes to DNA such as base-pair substitutions, whilesomatic mutations usually involve large deletions.b. Germ-line mutations occur during DNA replication, while somatic mutations do not. c. Germ-line mutations result in mutant gametes, while somatic mutations do not. d. Germ-line mutations are reversible, while somatic mutations are not. e. Germ-line mutations result in cancers, while somatic mutations do not. Answer: cSection 18.1Comprehension Question3. Which of the following base changes in DNA is an example of a transition?a. A-to-Cb. G-to-Cc. C-to-Ad. A-to-Ge. A-to-TAnswer: dSection 18.1Comprehension Question4. Which of the following correctly describes nonsense mutations?a. They cause a nonfunctional amino acid to replace a functional amino acid.b. They change the nucleotide sequence of a gene but do not change the sequence of the resulting protein.c. They result in the insertion or deletion of a small number of nucleotides to the DNA. d. They convert a codon for a particular amino acid within a gene into a stop codon. e. They cannot revert or back mutate to wild-type. Answer : DSection 18.1Comprehension Question5. Assume that a base-pair substitution mutation converts a DNA triplet (AAT) to another DNA triplet (AAA). A second mutation now changes the AAA triplet to the GAA triplet. (UUA andCUU code for leucine and UUU codes for phenylalanine.) This second mutation is an example of a(n)a. transversion.b. intragenic suppressor.c. loss-of-function mutation.d. intergenic suppressor.e. frameshift.Answer: bSection 18.1Comprehension Question6. A example of a genetic disorder in humans that results from a loss-of-function mutation isa. cystic fibrosis.b. achondroplasia.c. Huntington disease.d. myotonic dystrophy.e. None of the above is correct.Answer: aSection 18.1Comprehension Question 7. Which of the following statements about somatic mutations is FALSE?a. Some may give rise to cancers in humans and other animals. b. They may be inherited by daughter cells after cell division.c. They may result in inactive gene products of the mutated genes. d. They may result from both frameshift and base-pair substitution mutations.e. They may be inherited in the offspring of mutated individuals. Answer: eSection 18.1Comprehension Question8. Fragile-X syndrome is an example of a disease caused by what type of mutation?a. Nonsense mutation b. Frameshift mutation c. Expanding nucleotide repeatd. Loss-of-functione. Gain-of-function Answer: cSection 18.1Comprehension Question9. Which of the following types of mutations does NOT lead to a change in the amino acid sequence of the gene product?a. Missenseb. Nonsensec. Neutral d. Silente. Loss-of-functionAnswer: dSection 18.1Comprehension Question10. Insertion or removal of one or more nucleotide base pairs in DNA within a gene often results in a ____________ mutation.a. transitionb. frameshift c. reversiond. transversion e. suppressorAnswer: bSection 18.1Comprehension Question11. A _________ mutation changes a codon that specifies an amino acid into one that terminates translation. a. missense b. nonsense c. silentd. neutrale. reverseAnswer: bSection 18.1Comprehension Question12. __________ mutations produce new activities and are usually dominant. a. Induced b. Spontaneousc. Forwardd. Gain-of-functione. LethalAnswer: dSection 18.1Comprehension Question13. Which of the following kinds of mutations is most likely to be null loss-of-function?a. Transitionb. Transversionc. Frameshiftd. Missensee. InducedAnswer: cSection 18.1Comprehension Question14. The mutation shown in the diagram below can best be described as a _____________ mutation. a. missense b. nonsense c. silentd. neutrale. reverse Answer: aSection 18.1Comprehension Question15. Which of the following statements about an animal bearing a somatic mutation is TRUE?a. Some, but not all, of the animal’s offspring will also carry the mutation.b. All of the animal’s offspring will carry the mutation.c. Both the animal and its offspring will show the mutant trait.d. The animal but not its offspring can be affected by the mutation.e. The gametes produced by the animal will all carry the mutation.Answer: dSection 18.1Comprehension Question16. A mutation that changes a GC base pair to AT is a(n) a. transition.b. transversion.c. induced mutation.d. missense mutation.e. synonymous mutation.Answer: aSection 18.1Comprehension Question17. Huntington disease can strike at an earlier age and bring about a more rapid degeneration anddeath in successive generations within a family. This phenomenon can be explained by whichmechanism?a. Presence of a transposable element in the geneb. Chronic exposure to mutagens in the environmentc. Expansion of a trinucleotide repeat in the coding sequence of the gened. Presence of an extra chromosome in the germ linee. Absence of a gene product that is involved in DNA repairAnswer: cSection 18.1Comprehension Question18. What is the consequence of a transversion mutation in duplex DNA?a. A purine is replaced by a pyrimidine, and a pyrimidine is replaced by a purine.b. A base pair is lost within the DNA of a gene, which causes a reading frame shift.c. A purine is replaced by another purine, and a pyrimidine is replaced by another pyrimidine.d. A base pair is added to the DNA within a gene, which causes a reading frame shift.e. The sequence of the DNA remains the same since the change involves proteins.Answer: aSection 18.1Comprehension Question19. Achondroplasia is a form of dwarfism that is inherited in humans as an autosomal dominant. A survey in a small country showed that, within a two-year period, there were 12 children with normal parents born with this disorder out of a total of 420,000 births. What is the mutation rate in mutations/locus/generation?a. 1.4  10-5 b. 2.8  10-6 c. 2.5  10-5d. 2.8  10-5e. 7.4  10-6Answer: aSection