DOC PREVIEW
Missouri S&T BIO SCI 231 - Genetics Exam 4

This preview shows page 1-2 out of 6 pages.

Save
View full document
Premium Document
Do you want full access? Go Premium and unlock all 6 pages.
Access to all documents
Download any document
Ad free experience

Unformatted text preview:

BioSc 231 General Genetics Exam 4 Name Multiple Choice 2 points each Type of mutation in which a pyrimidine is substituted for a purine A Transition B Transversion C Frameshift D Conversion E Inversion Type of mutation caused by an addition or deletion of a base in a polypeptide encoding part of a gene A Transition B Transversion C Frameshift D Conversion E Inversion Type of mutation in which a purine is substituted for a purine A Transition B Transversion C Frameshift D Conversion E Inversion A type of microorganism that can exist on minimal medium A Conditional B Lethal C Auxotroph D Prototroph E Autotroph A mutation that causes a mutant phenotype only under restrictive conditions A Conditional B Lethal C Auxotroph D Prototroph E Autotroph A biochemical mutant that must be supplied with a particular nutrient for growth A Conditional B Lethal C Auxotroph D Prototroph E Autotroph A base change resulting in a codon specifying the same amino acid as found in the wild type polypeptide A Missense B Silent C Nonsense D Synonymous E Frameshift A base change resulting in a codon specifying an amino acid which is different than in the wild type polypeptide A Missense B Silent C Nonsense D Synonymous E Frameshift A base change that changes a codon for an amino acid to a stop codon A Missense B Silent C Nonsense D Synonymous E Frameshift After mutagen treatment a molecule of 2 aminopurine an adenine analogue incorporates into DNA During replication the 2 AP protonates caussing it to base pair like guanine The mutational event caused by this will be A AT to CG B GC to AT C AT to TA D AT to GC E GC to CG A researcher studying hemoglobin predicts that a histidine within the protein is important for binding oxygen She used sitedirected mutagenesis to change a codon for histidine CAU to one for lysine AAA However the mutant hemoglobin still binds oxygen just as well as the wild type and has no other apparent changes This type of mutation is called A suppression B synonymous C nonsense D silent E frameshift A new Penicillium mutant was tested for auxotrophy The mutant grows on minimal medium M arginine A proline P M P histidine H M A H P but not on M or on M A H The mutant requires A Arginine B Histidine and proline C Histidine D Arginine and proline E Proline A bacterial histidine mutant was plated on minimal medium A single colony grew This colony must have arisen from a A forward mutation B suppressor mutation C auxotrophic mutation D back mutation E back mutation OR suppressor mutation A mutant allele of corn leads to absence of red anthocyanin pigment in the kernel absence of anthocyanin results in a yellow color The allele however is unstable reverting quite late yet often in development The expected phenotype of kernels homozygous for this mutation is A fully red B yellow with many large red spots C yellow with few large red spots D yellow with many small red spots E yellow with few small red spots The fluctuation test of Luria and Delbruck studying resistance to bacteriophge T1 infection established that A T1 phage was a mutagen B Mutations could arise prior to the time they were selected C The mutation rate varies greatly from experiment to experiment D In E coli the number of mutants per clone was relatively constant E coli cells were spread on two agar plates one containing only agar plate 1 and the second containing streptomycin plate 2 which kills all cells except those that are resistant mutants Both plates were allowed to grow for several generations Cells were collected from the agar plate WITHOUT streptomycin and spread again on a fresh agar plate containing streptomycin plate 3 More mutants were observed on plate 3 than were observed on plate 2 The experiment demonstrates A how to screen for environmental mutagens B that mutation occurs in prokaryotes as well as in eukaryotes C that in some cases mutations are caused by the selective agent itself D that mutations occur in the absence of the selective agent E a direct correlation between the amount of the selective agent used and the number of resistant mutants one hit relationship Forty units of enzyme A are needed to produce a wild type phenotype The wild type allele produces 20 units and a new mutation produces only five units The mutation would be A dominant B codominant C recessive D conditional An individual cell homozygous for a mutant allele of the gene for a human enzyme contains no detectable activity for that enzyme The mutation is best described as A dominant B codominant C prototrophic D null The rare enol form of thymine pairs with guanine If a thymine enolization occurs during replication what would be the mutational event A CG to AT B GC to TA C AT to TA D TA to CG A missense mutation in Neurospora will revert by treatment with nitrous acid causes transversions but not by hydroxylamine causes AT GC transitions The original mutation not the reversion must have been A AT to GC B AT to TA C AT to CG D GC to AT A wild type chromosome can be represented as ABC DEFGH and from this a chromosomal aberration arises that can be represented AED CBFGH This is known as centromere A Deletion B Pericentric inversion C Translocation D Paracentric inversion E Duplication A female Drosophila supposedly heterozygous for two recessive mutations cn and lz that are on the same arm of the X chromosome cn lz surprisingly expresses both these genes The male progeny of the female will be A all wild type B all cn lz C 1 2 cn lz and 1 2 wild type D cn E lz A set of Drosophila deletions was assembled as follows the lines indicate the region that has been deleted Regions 1 2 3 4 5 6 7 a b c d e f A radioactive DNA fragment containing a certain gene bound only to chromosomes a and f The gene must be in the region between A 1 and 2 B 2 and 3 C 3 and 4 D 4 and 5 E 5 and 6 An enzyme that repairs thymine dimers in visible light in E coli A resolvase B polymerase C photolyase D excision repair E DNA glycosylase An enzyme that attacks sites left after loss of a single purine A resolvase B polymerase C photolyase D AP endonuclease E DNA glycosylase Problems variable points each 5 pts Using the table below determine the amino acid sequence of the polypeptide produced by the following messenger RNA ACGUAUGGCGACGUUGCGUUUUCGCUGCUGCAUGAACCGAGAUUGACGCUAAGGCAUGAAAA 2 pt A single base change in the above sequence results in a polypeptide that is only 7 amino acids in length Which codon is changed and what is the change 2 pts Cancer causing agents are


View Full Document

Missouri S&T BIO SCI 231 - Genetics Exam 4

Download Genetics Exam 4
Our administrator received your request to download this document. We will send you the file to your email shortly.
Loading Unlocking...
Login

Join to view Genetics Exam 4 and access 3M+ class-specific study document.

or
We will never post anything without your permission.
Don't have an account?
Sign Up

Join to view Genetics Exam 4 and access 3M+ class-specific study document.

or

By creating an account you agree to our Privacy Policy and Terms Of Use

Already a member?