BioSc 231 General Genetics Exam 3 Name __________________________________Multiple Choice. (2 points each)1) _____The base Guanine is always paired with ___.A. AdenineB. GuanineC. CytosineD. Thymine2) _____ Which of the following describes the structure of DNA?A. A double helix with two parallel strands.B. A double helix with two anti-parallel strands.C. A double helix with variable thickness depending on the base paring3) _____ The role of tRNA is:A. to serve as an intermediate in the decoding of genes.B. to act as transporters bringing amino acids to the site of protein synthesis.C. to serve as general translational components of the ribosome.D. to facilitate splicing of pre-messenger RNAs.E. to facilitate protein trafficking in protein secretion.4) _____ ___ is an enzyme that links Okazaki fragments together after the RNA primers have been replaced by DNA.A. origin of replicationB. convertaseC. primaseD. ligaseE. topoisomerase5) _____ Which of the following is NOT a property of RNA?A. It is double strandedB. It contains the sugar riboseC. Uracil replaces thymineD. It is found in the nucleusE. All of the above6) _____ Which of the following constitutes the primary structure of a protein?A. The folding of a polypeptide chain.B. The linear sequence of amino acids in a polypeptide chain.C. The polypeptide chains stacked on top of each other.D. A pleated sheet.E. Several polypeptide subunits. 7) _____ The chemical bond in a polypeptide by which the carboxyl group of one amino acid is linked to the amino group of theadjacent amino acid is called a(n) ____ bond.A. phosphodiesterB. peptide C. hydrogenD. hydrophobicE. hydrophilic8) _____ During the process or translation, as the ribosome moves down the mRNA and exposes the codon for the next amino acid in the chain, an acylated tRNA with the appropriate anti-codon enters the ___ of the large ribosomal subunit.A. A siteB. P siteC. E siteD. S site9) _____ Which of the following are role(s) of the 5’ cap on eukaryotic mRNA?A. The cap helps the RNA polymerase find the promoter and initiate transcription.B. The cap plays a role in the removal of introns.C. The cap acts as a binding site for the ribosome.D. none of the above.10) _____ The RNA polymerase that produces the primer necessary for DNA synthesis is called the ___.A. origin of replicationB. convertaseC. primaseD. ligaseE. topoisomerase11) _____ In what cellular compartment are introns removed from pre-mRNA to make mature mRNA?A. cytoplasmB. nucleusC. golgi bodiesD. mmitochondriaE. endoplasmic reticulum12) _____ In prokaryotic organisms, normal self-termination of transcription occurs due to the presence of A. stem-loop sequences at the 3’ end of the mRNAB. multiple stop codonsC. multiple RNA polymerase moleculesD. histones13) _____ The sigma factor protein’s role in transcription in E. coli includes which of the following?A. helps the RNA polymerase to bind to the promoterB. contributes to the proofreading activity of RNA polymeraseC. required for continued extension of the RNA moleculeD. plays a role in transcription terminationE. all of the above14) _____ Which of the following is not a modification of eukaryotic mRNA?A. Intron removalB. Coupling of transcription and translationC. 3' polyadenylationD. mRNA capping15) _____ Which of the following is true for histones?A. They are rich in acidic amino acidsB. They are associated with the nucleosome..C. They are found in the endoplasmic reticulum.D. They form the scaffolding structure.Enzyme Activity0 1 2 3 4Time (hrs)Addition ofsubstrate16) _____ The lac repressor protein controls expression of the lac operon via ______A. binding to the lac structural genes to repress expressionB. binding of the lac Z and lac Y genes onlyC. binding to the lac promoter site to repress expressionD. binding to the lac operator site to repress expressionShort Answer. (variable points)17) Griffith did a series of experiments with R and S cells that were injected into mice. What did his experiments show? (2 points)18) If the GC content of a DNA molecule is 44 percent, what are the percentages of each of the four bases (A,T,C and G)? (2 points)19) What is the function of transcription factors in eukaryotic transcription (2 points)20) What is the function of histones? (2 points)21) A scientist extracted the molecule shown to the right from a bacterial cell. Did this molecule come from RNA or DNA? Justify your answer (2 points)22) The figure at the right, illustrates expression of enzyme activity for a catabolic pathway that isregulated by an inducible repressor system. On the two lines below, draw the position of RNAP ( ), Repressor ( ), and inducer ( ) (if present) at both t0 and t3. (5 points)P O Z Y AP O Z Y At3t023) The following table contains a list of statements that apply to replication, transcription, both, or neither. In each empty box, put a check mark if that statement applies to replication or transcription. (8 points) Replication TranscriptionThe new strand is made 5’ to 3’. The new strand is made 3’ to 5’. The new strand is identical to the template strand, with the exception ofU’s replacing T’s. The new strand is complementary to the template strand. The template strand is RNA. The product is DNA. The product is RNA. An RNA primer is required to initiate synthesis. Synthesis of the new strand is initiated at a promoter. 24) Below is a segment of a double stranded DNA molecule containing a promoter sequence. Write the sequence of the RNA molecule that would be produced by the RNA polymerase binding to this promoter (up to the end of the molecule). (5 points) -35 -10 +15’-CGTTCGGATCGATGCCGATCAGCGGGTAGCGGGTGATCTCGGCCGCCGACACCTGCTTGCGGCCGGCCAGCTCGTGGCC–3’3’-GCAAGCCTAGCTACGGCTAGTCGCCCATCGCCCACTAGAGCCGGCGGCTGTGGACGAACGCCGGCCGGTCGAGCACCGG-5’25) The following questions refer to the numbers on this figure. (7 points)(Possible terms are on the next to last page)A. What end (5' or 3') of the molecule is indicated by arrow number 3?B. What enzyme functions at the location indicated by number 5 to form phosphodiester bonds between two existing DNA molecules.C. Is arrow 4 pointing to the template for the leading or lagging strand?D. What kind of nucleic acid is indicated by arrow number 7?E. What end (5' or 3') of the