BioSc 231 General Genetics Exam 3 Name __________________________________Multiple Choice. (1 point each)_____The base cytosine is always paired with ___.A. AdenineB. GuanineC. CytosineD. Thymine_____ The presence of a ___ with a free 3'-OH group is essential for DNA polymerase to synthesize DNA since no known DNA polymerase is able to initiate chains.A. origin of replicationB. restriction endonucleaseC. palindromeD. primerE. promoter_____ ___ is an enzyme that links Okazaki fragments together after the RNA primers have been replaced by DNA.A. origin of replicationB. convertaseC. primaseD. ligaseE. topoisomerase_____ The process of producing a RNA polymer from a DNA template is called __.A. replicationB. transcriptionC. translationD. duplication_____ The process of producing an amino acid polymer (polypeptide) from a RNA template is called __.A. replicationB. transcriptionC. translationD. duplication _____ The chemical bond in a polypeptide by which the carboxyl group of one amino acid is linked to the amino group of the adjacentamino acid is called a(n) ____ bond.A. phosphodiesterB. peptide C. hydrogenD. hydrophobicE. hydrophilic_____ During the process or translation, as the ribosome moves down the mRNA and exposes the codon for the next amino acid in thechain, an acylated tRNA with the appropriate anti-codon enters the ___ of the large ribosomal subunit.A. A siteB. P siteC. E siteD. S site_____ E. coli genomic DNA differs from a eukaryotic chromosome in that E. coli DNAA. has a single centromere.B. is circular.C. has telomeres.D. does not undergo supercoiling._____ The RNA polymerase that produces the primer necessary for DNA synthesis is called the ___.A. origin of replicationB. convertaseC. primaseD. ligaseE. topoisomerase_____ Which of the following is true regarding RNA processing?A. Involves removal of exonsB. Involves removal of one or more introns.C. Occurs in prokaryotesD. Occurs in the cytoplasm_____ In prokaryotic organisms, normal self-termination of transcription occurs due to the presence of A. stem-loop sequences at the 3’ end of the mRNAB. multiple stop codonsC. multiple RNA polymerase moleculesD. histones_____ The four ribonucleotide triphosphates incorporated into mRNA areA. Thymine, Uracil, Guanine, CytosineB. Inosine, Guanine, Uracil, ThymineC. Adenine, Guanine, Cytosine, ThymineD. Cytosine, Uracil, Adenine, Guanine_____ Which of the following is not a modification of eukaryotic mRNA?A. Intron removalB. Coupling of transcription and translationC. 3' polyadenylationD. mRNA capping_____ Which of the following is true for histones?A. They are rich in acidic amino acidsB. They are associated with the nucleosome..C. They are found in the endoplasmic reticulum.D. They form the scaffolding structure.Short Answer. (variable points)If the GC content of a DNA molecule is 62 percent, what are the percentages of the four bases (A,T,C and G)? (2 points)What is the function of transcription factors in eukaryotic transcription (2 points)Give an example of a type of polypeptide secondary structure (2 points).What is the function of histones? (1 point)The photograph to the right is an electronmicrograph that shows the process of activetranscription of several genes. The location ofone gene is indicated with a bar. Draw anarrow on the picture to indicate the direction oftranscription of the indicated gene. Brieflyexplain how you know the direction oftranscription. (4 points)Three unknown samples of bacteria were found in Griffith’s lab. The samples were injected individually and in all possible combinations into mice to figure out what is in each sample. Based on the results of this experiment, which are shown in the table to the right, what is in each sample? (6 points)Sample ASample BSample CSample Response Cells recoveredA None Live R cellsB None NoneC Dead Live S cellsA+B Dead Live S cellsA+C Dead Live R&S cellsB+C Dead Live S cellsA+B+C Dead Live S cellsThe following 5 questions refer to the numbers on this figure. (5 points)A. What end (5' or 3') of the molecule is indicated by arrow number 8?B. Is arrow 7 pointing to the template for the leading or lagging strand?C. What kind of nucleic acid is indicated by arrow number 4?D. What do you call the short DNA fragments indicated by arrow number 5?E. What enzyme (indicated by arrow 2) deals with supercoiling ahead of the replication fork?Translate the following mRNA using the single letter amino acid code (5 points)5’ GAGGCCGACGUGCCGACGUCAGAUGGAAAAUGAUGAAUUGCAUGCAACG GAGAGCCCAGAAGCAUCGUAACCAAAGGCUCCUUUUGGAGCUUUUUUUU 3’Meselson and Stahl used a heavy form of nitrogen to demonstrate semi-conservative DNA replication. Bacterial cells were grown in the presence of heavy nitrogen until all the DNA contained the heavy form. The bacteria were then transferred to a medium that only contained the light form of nitrogen. At different time points, DNA was isolated from the bacteria and subjected to density gradient ultracentrifugation. Use the following test tube pictures to indicate the location of the DNA band(s) at the beginning of the experiment, after 1 generation, after 2 generations and after 4 generations. (4 points)Beginning 1 Generation 2 Generations 4 GenerationsComplete the structure of the nucleotide below by filling in the boxes with the letter of the appropriate functional group. (3 points)Short Essay (8 points) Answer one of the following two questions.1. List the enzymes and proteins involved in DNA replication. Briefly describe the function of each.2. Using boxes or lines as a schematic representation of template DNA, mRNA and protein, diagram the parts indicated below (from a prokaryote).A) Promoter (-10 and -35)B) AUGC) Ribosome binding siteD) Coding sequenceE) Transcriptional terminatorF) Amino and carboxyl ends of the resulting protein.Below is a segment of a double stranded DNA molecule containing a promoter sequence. Write the sequence of the RNA molecule that would be produced by the RNA polymerase binding to this promoter (up to the end of the molecule). (4 points) -35 -10 +15’-CGTTCGGATCGATGCCGATCAGCGGGTAGCGGGTGATCTCGGCCGCCGACACCTGCTTGCGGCCGGCCAGCTCGTGGCC–3’3’-GCAAGCCTAGCTACGGCTAGTCGCCCATCGCCCACTAGAGCCGGCGGCTGTGGACGAACGCCGGCCGGTCGAGCACCGG-5’Bonus question. (4 pts) One of the earliest drugs used to treat patients with HIV infections was the nucleotide analog AZT. A nucleotide analog has a structureand function similar to a nucleotide. Some
View Full Document