5’ CGAGAUGAUAAACGAGAGGGGGGAAAAUGAGACGAUAUGCAGCUAAUGAGCAGGUUUUC 3’BioSc 231 General Genetics Exam 1 Name __________________________________Multiple Choice. (1 point each)_____ The chemical bonds in DNA by which the sugar components of adjacent nucleotides are linked through the phosphate groups are called ____ bonds.A. phosphodiester B. hydrogenC. hydrophobicD. hydrophilicE. ionic_____ The basic structure of a nucleotide includes the following components:A. amino acidsB. tryptophan and leucineC. base, sugar, phosphateD. mRNA, rRNA, tRNAE. phosphorous and sulfur_____ Which of the following is not an essential attribute that a biological molecule would need to be a useful genetic material?A. It must carry all of the information needed to direct the specific organization and metabolic activities of the cellB. It must replicate accurately so that the information it contains is precisely inherited by the daughter cellsC. It must be capable of undergoing occasional mutations, such that the information it carries is altered in a heritable wayD. It must have highly repetitive DNA sequences.E. All are essential attributes of useful genetic material._____ The presence of a ___ with a free 3'-OH group is essential for DNA polymerase to synthesize DNA since no known DNA polymerase is able to initiate chains.A. origin of replicationB. restriction endonucleaseC. palindromeD. primer_____ Considering the structure of double stranded DNA, what kinds of bonds hold one complementary strand to the other?A. ionicB. covalentC. Van der WaalsD. hydrogen_____ A ___ is an enzyme that recognizes a short nucleotide sequence in a DNA molecule and cleaves the molecule at that site.A. 5' - 3' exonucleaseB. 3' - 5' exonucleaseC. Taq polymeraseD. topoisomeraseE. restriction endonuclease_____ The technique used to separate molecules on the basis of their different rates of movement in an electric field is known as ____.A. gel electrophoresisB. gradient centrifugationC. ultracentrifugationD. Southern hybridizationE. PCR_____ A ___ involves the transfer of DNA fragments from a gel matrix to a nitrocellulose membrane where specific DNA sequences can be detected using radioactive probes.A. PCR reactionB. restriction enzyme digestC. DNA seqeuncing reactionD. Southern blot_____ In crosses involving two different unlinked traits, the ratio 9:3:3:1 indicates ___.A. CodominanceB. Independent assortment C. Intermediate dominanceD. Three alleles for each trait_____In a cross of a round hybrid pea with a true breeding round parent (Ww x WW), what genotypic proportions would be observed in the offspring?A. Half heterozygous, half homozygous dominantB. Half round, half wrinkledC. All heterozygousD. All round_____ The fundamental Mendelian process which involves the separation of alleles would be called ___.A. segregationB. independent assortmentC. continuous variationD. discontinuous variationE. dominance or recessiveness_____ What phenotypic or genotypic ratios typically result from crosses dealing with a single genetic locus?A. 9:3:3:1, 1:2:1B. 1:1:1:1, 1:4:6:4:1C. 3:1, 1:1, 1:2:1D. 9:7, 12:3:1E. 15:1, 1:2_____ The base thymine is always paired with ___.A. AdenineB. GuanineC. CytosineD. Thymine_____ The sequence of one strand of DNA is 5’ TCGATC 3’. The sequence of the complementary strand would be ___.A. 5’ AGCTAG 3’B. 5’ TCGATC 3’C. 5’ CTAGCT 3’D. 5’ GCTAGC 3’E. 5’ GATCGA 3_____ Starting with a cross between AA and aa in the P generation, the proportion of heterozygotes in the F2 progeny will be ___.A. 1/8B. 1/4C. 1/3D. 1/2E. All heterozygotes_____ Genotype is to DNA as phenotype is to A. GenotypeB. ProteinsC. ExpressivityD. RNAE. Mutation _____ Starting with a P generation with the following genotypes (AABB x aabb). Based on classical Mendelian inheritance, what is the expected phenotypic ratio observed among the F2 progeny?A. 9:3:3:1B. 1:2:1C. 3:1D. 1:1E. 1:1:1:1_____ In the previous question, if A = brown fur and a = red fur and B = straight tail and b = curled tail, what phenotypic class would be observed in the highest proportion? A. red – curled tailB. brown – curled tailC. red – straight tailD. brown – straight tail _____ A species of mice can have gray or black fur and long or short tails. A cross between black-furred, long-tailed mice and gray-furred, short-tailed mice produce all black-furred, long-tailed offspring. Using the gene symbols G for black, g for gray, S for long and s for short, what would be the genotype of a gray-furred, short-tailed mouse? A. WWSSB. wwSSC. wwssD. WwSsE. Wwss _____ Referring to the previous question, how many different gametes will the gray-furred, short-tailed P1 mice produce? A. 1B. 2C. 4D. 16_____ To determine if an organism with a dominant phenotype is heterozygous, one can perform a ___.A. reciprocal crossB. dihybrid crossC. test cross_____ In the F1 dihybrid cross (WwGg X WwGg), in which W = round, w = wrinkled, G = yellow and g = green, what is the probability of obtaining an individual that is round, green and true-breeding? A. 1/16B. 1/2C. 9/16D. 3/16_____ What genotype is present most often among the progeny (F2) of a dihybrid cross (AaBb X AaBb)? A. AaBbB. AABbC. AABBD. aabb____ The Hershey and Chase experiment which offered evidence in support of DNA being the genetic material in bacteriophage madeuse of the following labeled componentsA. phosphorous and sulfurB. nitrogen and oxygenC. tritiumD. hydrogen_____ Which of the following are pyrimidines?A. adenine and guanineB. thymine and cytosineC. thymine and adenineD. cytosine and guanine_____ The process of producing a RNA polymer from a DNA template is called __.A. replicationB. transcriptionC. translationD. duplication_____ The process of producing an amino acid polymer (polypeptide) from a RNA template is called __.A. replicationB. transcriptionC. translationD. duplication_____ The basic principle that DNA makes RNA makes protein is referred to as the __.A. Golden rule of molecular biologyB. Central dogma of molecular biologyC. Core of molecular biologyD. Gene that laid the golden eggShort Answer. (1 point each)If one of the strands of a piece of DNA has the sequence 5'-GAGCCATGGTC-3', what is the sequence of the complementary strand? Label the termini as 5' or 3'. Synthesis of DNA is catalyzed by an enzyme called _____________________________and synthesis of RNA is catalyzed by an enzyme known as ____________________________.In your own words, what is the meaning of the term