BioSc 231 General Genetics Exam 5 Name __________________________________Multiple Choice. (3 points each)1) ______ A population is reproductively isolated. Which of the following is primarily responsible for the introduction of new alleles at genetic loci into the population?A. Independent assortment during meiosisB. Germ line mutationsC. Assortive matingD. InbreedingE. Somatic cell mutations2) ______ Which of the following is primarily responsible for the frequency with which an allele is present in the population?A. The DNA sequence near the alleleB. Germ line mutationsC. Natural selectionD. Its starting frequencyE. Whether or not it is in genic or nongenic DNA3) ______ Mutations:A. Happen more frequently if they confer a selective advantageB. Are, by definition, heritable changes in DNA in germ line cells onlyC. Are always neutral or a detriment to reproductive fitnessD. Are best discussed in terms of heritable changes to the DNA of cells or organismsE. Are best discussed in terms of allele frequencies in a population4) ______ A given allele that results in a disease state in humans may nevertheless be propagated in the population because:A. The disease has a late onset, typically after affected individuals have already reproduced.B. An individual heterozygous for the disease allele and a wild-type allele has a reproductively selective advantage.C. It impairs reproductive fitness but not individual fitness.D. A and bE. All of the above5) ______ Four percent of mice had a recessive disorder. What percentage of the population are homozygous dominant?A. 16%B. 32%C. 64%D. 80%6) ______ You wish to probe a human cDNA library to find out which insert has the β-globin gene. Which of the following would be a good choice as your probe (assume in all cases your probe is labeled)?A. A 30 nucleotide oligo corresponding to intron 1B. A 30 nucleotide oligo corresponding to exon 1C. A 30 nucleotide oligo corresponding to a β-globin gene enhancerD. All of the aboveE. None of the above7) ______ Which of the following DNA duplexes is most stable?A. 5’ AATTAATTAATTAATTAATT 3’3’ TTAATTAATTAATTAATTAA 5’B. 5’ GGCCGGCCGGCCGGCCGGCC 3’3’ CCGGCCGGCCGGCCGGCCGG 5’C. 5’ GGCCGGCCGGCCGGCCGGCC 3’3’ CCGGCCGGAAGGCCGGCCGG 5’D. All are equally stable.8) ______ A single nucleotide polymorphism is:A. Always found in genic DNA that is noncodingB. Variable in length, depending on the polymorphismC. Detectable by DNA sequencing onlyD. A point mutationE. Most often caused by “slippage” during replication9) ______ You have a 3 kb piece of DNA corresponding to a portion of the human dystrophin gene. You also have a 3 kb plasmid vector (for cloning in E. coli). Which of the following is likely common to both of these DNA fragments?A. Restriction enzyme sitesB. A polylinkerC. A selectable markerD. An origin of replicationE. None of the above10) ______ A population is reproductively isolated. Which of the following is primarily responsible for the introduction of new allelesat genetic loci into the population?A. Independent assortment during meiosisB. Germ line mutationsC. Assortive matingD. InbreedingE. Somatic cell mutations 11) _____ The total collection of genes in a population is called the ____.A. gene poolB. gene libraryC. equilibriumD. cDNA12) ______ Why is it necessary to have a selectable marker on a plasmid vector when transforming a host cell such as E. coli?A. Only plasmids containing a selectable marker can be taken up by an E. coli cell.B. The selectable marker is necessary to circularize the plasmid, and without that, no transformation occurs.C. Transformation is so efficient that without a selectable marker, each E. coli cell would take up several plasmids.D. Transformation is so inefficient that the majority of E. coli cells will not have taken up the plasmid.E. None of the above13) ______ In order to “read” the 5’ to 3’ sequence of a segment of DNA after analyzing the products of a Sanger DNA sequencing reaction by polyacrylamide gel electrophoresis, you should:A. Read the fragments on the gel from top to bottom, in order of increasing size.B. Read the fragments on the gel from bottom to top, in order of increasing size.C. Read each lane individually from top to bottom and pool the results.D. All of the above are legitimate approaches.E. None of the above14) _____ Enzyme that cleaves DNA at sequence-specific sites is calledA. DNA polymeraseB. ligaseC. restriction endonucleaseD. sticky endsE. cDNA15) _____ DNA termini with overhangs produced by endonuclease digestion are calledA. sticky endsB. blunt endsC. oligonucleotidesD. none of the above16) _____Which enzyme functions to polymerize DNA from an RNA template?A. DNA polymeraseB. RNA polymeraseC. Reverse transcriptaseD. LigaseE. Endonuclease17) _____ Differing sizes of restriction fragments produced from the alleles of a gene constituteA. a southern blotB. an allozymeC. identification of a geneD. a restriction fragment length polymorphism18) _____Which of the following is NOT a typical component of a polymerase chain reaction (PCR) reactionA. PrimerB. Ligase C. TemplateD. Taq DNA polymeraseE. Buffer19) _____Plasmids used in vitro to clone foreign DNA fragments are calledA. TransgenicB. cDNAC. ClonesD. VectorsE. Conjugants20) _____ A restriction fragment containing a specific gene of interest can be identified by gel electrophoresis followed by transferringthe DNA to a membrane as a solid support matrix using a procedure calledA. a Southern blotB. an allozymeC. identification of a geneD. a restriction fragment length polymorphism21) _____ cDNA is A. chromosomal DNA which has been isolated from a donor organism.B. complementary DNA that is generated by using reverse transcriptase to make DNA from mRNA.C. cloned DNA that has been introduced into a cloning vector.D. cut DNA that has been digested with a restriction endonuclease for use in a cloning experiment.22) _____ The truth is that everyone has at least a handful of "problem" genes. Which of the following factors would result in your genes never causing you troubleA. if you only have some, but not all, of the genes that come into play to cause a particular disease.B. if your genes for disorders don't express themselves stronglyC. if our genes for disorders are recessive and you inherit only one copyD. all of the aboveE. none of the aboveShort Answer (variable points) (2 pts) The restriction endonuclease HindIII (which cuts at the sequence AAGCTT) cuts the
View Full Document