BioSc 231 General Genetics Exam 3 Name Multiple Choice 2 points each 1 The base Guanine is always paired with A B C D Adenine Guanine Cytosine Thymine 2 Which of the following describes the structure of DNA A A double helix with two parallel strands B A double helix with two anti parallel strands C A double helix with variable thickness depending on the base paring 3 The role of tRNA is A B C D E to serve as an intermediate in the decoding of genes to act as transporters bringing amino acids to the site of protein synthesis to serve as general translational components of the ribosome to facilitate splicing of pre messenger RNAs to facilitate protein trafficking in protein secretion 4 is an enzyme that links Okazaki fragments together after the RNA primers have been replaced by DNA A B C D E origin of replication convertase primase ligase topoisomerase 5 Which of the following is NOT a property of RNA A B C D E It is double stranded It contains the sugar ribose Uracil replaces thymine It is found in the nucleus All of the above 6 Which of the following constitutes the primary structure of a protein A B C D E The folding of a polypeptide chain The linear sequence of amino acids in a polypeptide chain The polypeptide chains stacked on top of each other A pleated sheet Several polypeptide subunits 7 The chemical bond in a polypeptide by which the carboxyl group of one amino acid is linked to the amino group of the adjacent amino acid is called a n bond A B C D E phosphodiester peptide hydrogen hydrophobic hydrophilic 8 During the process or translation as the ribosome moves down the mRNA and exposes the codon for the next amino acid in the chain an acylated tRNA with the appropriate anti codon enters the of the large ribosomal subunit A B C D A site P site E site S site 9 Which of the following are role s of the 5 cap on eukaryotic mRNA A B C D The cap helps the RNA polymerase find the promoter and initiate transcription The cap plays a role in the removal of introns The cap acts as a binding site for the ribosome none of the above 10 The RNA polymerase that produces the primer necessary for DNA synthesis is called the A B C D E origin of replication convertase primase ligase topoisomerase 11 In what cellular compartment are introns removed from pre mRNA to make mature mRNA A B C D E cytoplasm nucleus golgi bodies mmitochondria endoplasmic reticulum 12 In prokaryotic organisms normal self termination of transcription occurs due to the presence of A B C D stem loop sequences at the 3 end of the mRNA multiple stop codons multiple RNA polymerase molecules histones 13 The sigma factor protein s role in transcription in E coli includes which of the following A B C D E helps the RNA polymerase to bind to the promoter contributes to the proofreading activity of RNA polymerase required for continued extension of the RNA molecule plays a role in transcription termination all of the above 14 Which of the following is not a modification of eukaryotic mRNA A B C D Intron removal Coupling of transcription and translation 3 polyadenylation mRNA capping 15 Which of the following is true for histones A B C D They are rich in acidic amino acids They are associated with the nucleosome They are found in the endoplasmic reticulum They form the scaffolding structure 16 The lac repressor protein controls expression of the lac operon via A B C D binding to the lac structural genes to repress expression binding of the lac Z and lac Y genes only binding to the lac promoter site to repress expression binding to the lac operator site to repress expression Short Answer variable points 17 Griffith did a series of experiments with R and S cells that were injected into mice What did his experiments show 2 points 18 If the GC content of a DNA molecule is 44 percent what are the percentages of each of the four bases A T C and G 2 points 19 What is the function of transcription factors in eukaryotic transcription 2 points 20 What is the function of histones 2 points 22 The figure at the right illustrates expression of enzyme activity for a catabolic pathway that is regulated by an inducible repressor system On the two lines below draw the position of RNAP Repressor and inducer if present at both t0 and t3 5 points Enzyme Activity 21 A scientist extracted the molecule shown to the right from a bacterial cell Did this molecule come from RNA or DNA Justify your answer 2 points Addition of substrate t0 P O Z Y A 0 t3 P O Z Y A 1 2 3 Time hrs 4 23 The following table contains a list of statements that apply to replication transcription both or neither In each empty box put a check mark if that statement applies to replication or transcription 8 points Replication Transcription The new strand is made 5 to 3 The new strand is made 3 to 5 The new strand is identical to the template strand with the exception of U s replacing T s The new strand is complementary to the template strand The template strand is RNA The product is DNA The product is RNA An RNA primer is required to initiate synthesis Synthesis of the new strand is initiated at a promoter 24 Below is a segment of a double stranded DNA molecule containing a promoter sequence Write the sequence of the RNA molecule that would be produced by the RNA polymerase binding to this promoter up to the end of the molecule 5 points 35 10 1 5 CGTTCGGATCGATGCCGATCAGCGGGTAGCGGGTGATCTCGGCCGCCGACACCTGCTTGCGGCCGGCCAGCTCGTGGCC 3 3 GCAAGCCTAGCTACGGCTAGTCGCCCATCGCCCACTAGAGCCGGCGGCTGTGGACGAACGCCGGCCGGTCGAGCACCGG 5 25 The following questions refer to the numbers on this figure 7 points Possible terms are on the next to last page A What end 5 or 3 of the molecule is indicated by arrow number 3 B What enzyme functions at the location indicated by number 5 to form phosphodiester bonds between two existing DNA molecules C Is arrow 4 pointing to the template for the leading or lagging strand D What kind of nucleic acid is indicated by arrow number 7 E What end 5 or 3 of the molecule is indicated by arrow number 8 F What do you call the short DNA fragments indicated by arrow number 6 G What enzyme indicated by arrow 2 unwinds the DNA at the replication fork 26 Translate the following mRNA using the single letter amino acid code You can tear off the last page to read the table 5 points 5 GAGGCCGAUGUACGGCGAGAAUGAAUCAGCGAGGGAGGGCAGAGAAGAGAACUAGGAGCUUUUUUUU 3 27 Meselson and Stahl used a heavy form of nitrogen to demonstrate semi conservative DNA replication Bacterial cells were grown in the