DOC PREVIEW
Missouri S&T BIO SCI 231 - BioSc 231 Exam 3

This preview shows page 1-2-3 out of 8 pages.

Save
View full document
Premium Document
Do you want full access? Go Premium and unlock all 8 pages.
Access to all documents
Download any document
Ad free experience

Unformatted text preview:

BioSc 231 General Genetics Exam 3 Name Multiple Choice 1 point each The base cytosine is always paired with A B C D Adenine Guanine Cytosine Thymine The presence of a with a free 3 OH group is essential for DNA polymerase to synthesize DNA since no known DNA polymerase is able to initiate chains A B C D E origin of replication restriction endonuclease palindrome primer promoter is an enzyme that links Okazaki fragments together after the RNA primers have been replaced by DNA A B C D E origin of replication convertase primase ligase topoisomerase The process of producing a RNA polymer from a DNA template is called A B C D replication transcription translation duplication The process of producing an amino acid polymer polypeptide from a RNA template is called A B C D replication transcription translation duplication The chemical bond in a polypeptide by which the carboxyl group of one amino acid is linked to the amino group of the adjacent amino acid is called a n bond A B C D E phosphodiester peptide hydrogen hydrophobic hydrophilic During the process or translation as the ribosome moves down the mRNA and exposes the codon for the next amino acid in the chain an acylated tRNA with the appropriate anti codon enters the of the large ribosomal subunit A B C D A site P site E site S site E coli genomic DNA differs from a eukaryotic chromosome in that E coli DNA A B C D has a single centromere is circular has telomeres does not undergo supercoiling The RNA polymerase that produces the primer necessary for DNA synthesis is called the A B C D E origin of replication convertase primase ligase topoisomerase Which of the following is true regarding RNA processing A B C D Involves removal of exons Involves removal of one or more introns Occurs in prokaryotes Occurs in the cytoplasm In prokaryotic organisms normal self termination of transcription occurs due to the presence of A B C D stem loop sequences at the 3 end of the mRNA multiple stop codons multiple RNA polymerase molecules histones The four ribonucleotide triphosphates incorporated into mRNA are A B C D Thymine Uracil Guanine Cytosine Inosine Guanine Uracil Thymine Adenine Guanine Cytosine Thymine Cytosine Uracil Adenine Guanine Which of the following is not a modification of eukaryotic mRNA A B C D Intron removal Coupling of transcription and translation 3 polyadenylation mRNA capping Which of the following is true for histones A B C D They are rich in acidic amino acids They are associated with the nucleosome They are found in the endoplasmic reticulum They form the scaffolding structure Short Answer variable points If the GC content of a DNA molecule is 62 percent what are the percentages of the four bases A T C and G 2 points What is the function of transcription factors in eukaryotic transcription 2 points Give an example of a type of polypeptide secondary structure 2 points What is the function of histones 1 point The photograph to the right is an electron micrograph that shows the process of active transcription of several genes The location of one gene is indicated with a bar Draw an arrow on the picture to indicate the direction of transcription of the indicated gene Briefly explain how you know the direction of transcription 4 points Three unknown samples of bacteria were found in Griffith s lab The samples were injected individually and in all possible combinations into mice to figure out what is in each sample Based on the results of this experiment which are shown in the table to the right what is in each sample 6 points Sample A Sample B Sample C Sample Response Cells recovered A None Live R cells B None None C Dead Live S cells A B Dead Live S cells A C Dead Live R S cells B C Dead Live S cells A B C Dead Live S cells The following 5 questions refer to the numbers on this figure 5 points A What end 5 or 3 of the molecule is indicated by arrow number 8 B Is arrow 7 pointing to the template for the leading or lagging strand C What kind of nucleic acid is indicated by arrow number 4 D What do you call the short DNA fragments indicated by arrow number 5 E What enzyme indicated by arrow 2 deals with supercoiling ahead of the replication fork Translate the following mRNA using the single letter amino acid code 5 points 5 GAGGCCGACGUGCCGACGUCAGAUGGAAAAUGAUGAAUUGCAUGCAACG GAGAGCCCAGAAGCAUCGUAACCAAAGGCUCCUUUUGGAGCUUUUUUUU 3 Meselson and Stahl used a heavy form of nitrogen to demonstrate semi conservative DNA replication Bacterial cells were grown in the presence of heavy nitrogen until all the DNA contained the heavy form The bacteria were then transferred to a medium that only contained the light form of nitrogen At different time points DNA was isolated from the bacteria and subjected to density gradient ultracentrifugation Use the following test tube pictures to indicate the location of the DNA band s at the beginning of the experiment after 1 generation after 2 generations and after 4 generations 4 points Beginning 1 Generation 2 Generations 4 Generations Complete the structure of the nucleotide below by filling in the boxes with the letter of the appropriate functional group 3 points Short Essay 8 points Answer one of the following two questions 1 List the enzymes and proteins involved in DNA replication Briefly describe the function of each 2 Using boxes or lines as a schematic representation of template DNA mRNA and protein diagram the parts indicated below from a prokaryote A Promoter 10 and 35 B AUG C Ribosome binding site D Coding sequence E Transcriptional terminator F Amino and carboxyl ends of the resulting protein Below is a segment of a double stranded DNA molecule containing a promoter sequence Write the sequence of the RNA molecule that would be produced by the RNA polymerase binding to this promoter up to the end of the molecule 4 points 35 10 1 5 CGTTCGGATCGATGCCGATCAGCGGGTAGCGGGTGATCTCGGCCGCCGACACCTGCTTGCGGCCGGCCAGCTCGTGGCC 3 3 GCAAGCCTAGCTACGGCTAGTCGCCCATCGCCCACTAGAGCCGGCGGCTGTGGACGAACGCCGGCCGGTCGAGCACCGG 5 Bonus question 4 pts One of the earliest drugs used to treat patients with HIV infections was the nucleotide analog AZT A nucleotide analog has a structure and function similar to a nucleotide Some of the nucleotide analogs being used to treat HIV infections are called dideoxy nucleotides Dideoxy nucleotides include a ribose sugar that lacks both a 2 and 3 hydroxyl group Based on what you know about nucleic acid synthesis what effect do you think these analogs have on viral nucleic acid synthesis


View Full Document

Missouri S&T BIO SCI 231 - BioSc 231 Exam 3

Download BioSc 231 Exam 3
Our administrator received your request to download this document. We will send you the file to your email shortly.
Loading Unlocking...
Login

Join to view BioSc 231 Exam 3 and access 3M+ class-specific study document.

or
We will never post anything without your permission.
Don't have an account?
Sign Up

Join to view BioSc 231 Exam 3 and access 3M+ class-specific study document.

or

By creating an account you agree to our Privacy Policy and Terms Of Use

Already a member?