BioSc 231 General Genetics Exam 5 Name Multiple Choice 3 points each 1 A population is reproductively isolated Which of the following is primarily responsible for the introduction of new alleles at genetic loci into the population A B C D E Independent assortment during meiosis Germ line mutations Assortive mating Inbreeding Somatic cell mutations 2 Which of the following is primarily responsible for the frequency with which an allele is present in the population A B C D E The DNA sequence near the allele Germ line mutations Natural selection Its starting frequency Whether or not it is in genic or nongenic DNA 3 Mutations A B C D E Happen more frequently if they confer a selective advantage Are by definition heritable changes in DNA in germ line cells only Are always neutral or a detriment to reproductive fitness Are best discussed in terms of heritable changes to the DNA of cells or organisms Are best discussed in terms of allele frequencies in a population 4 A given allele that results in a disease state in humans may nevertheless be propagated in the population because A B C D E The disease has a late onset typically after affected individuals have already reproduced An individual heterozygous for the disease allele and a wild type allele has a reproductively selective advantage It impairs reproductive fitness but not individual fitness A and b All of the above 5 Four percent of mice had a recessive disorder What percentage of the population are homozygous dominant A B C D 16 32 64 80 6 You wish to probe a human cDNA library to find out which insert has the globin gene Which of the following would be a good choice as your probe assume in all cases your probe is labeled A B C D E A 30 nucleotide oligo corresponding to intron 1 A 30 nucleotide oligo corresponding to exon 1 A 30 nucleotide oligo corresponding to a globin gene enhancer All of the above None of the above 7 Which of the following DNA duplexes is most stable A 5 AATTAATTAATTAATTAATT 3 TTAATTAATTAATTAATTAA B 5 GGCCGGCCGGCCGGCCGGCC 3 CCGGCCGGCCGGCCGGCCGG C 5 GGCCGGCCGGCCGGCCGGCC 3 CCGGCCGGAAGGCCGGCCGG D All are equally stable 3 5 3 5 3 5 8 A single nucleotide polymorphism is A B C D E Always found in genic DNA that is noncoding Variable in length depending on the polymorphism Detectable by DNA sequencing only A point mutation Most often caused by slippage during replication 9 You have a 3 kb piece of DNA corresponding to a portion of the human dystrophin gene You also have a 3 kb plasmid vector for cloning in E coli Which of the following is likely common to both of these DNA fragments A B C D E Restriction enzyme sites A polylinker A selectable marker An origin of replication None of the above 10 A population is reproductively isolated Which of the following is primarily responsible for the introduction of new alleles at genetic loci into the population A B C D E Independent assortment during meiosis Germ line mutations Assortive mating Inbreeding Somatic cell mutations 11 The total collection of genes in a population is called the A B C D gene pool gene library equilibrium cDNA 12 Why is it necessary to have a selectable marker on a plasmid vector when transforming a host cell such as E coli A B C D E Only plasmids containing a selectable marker can be taken up by an E coli cell The selectable marker is necessary to circularize the plasmid and without that no transformation occurs Transformation is so efficient that without a selectable marker each E coli cell would take up several plasmids Transformation is so inefficient that the majority of E coli cells will not have taken up the plasmid None of the above 13 In order to read the 5 to 3 sequence of a segment of DNA after analyzing the products of a Sanger DNA sequencing reaction by polyacrylamide gel electrophoresis you should A B C D E Read the fragments on the gel from top to bottom in order of increasing size Read the fragments on the gel from bottom to top in order of increasing size Read each lane individually from top to bottom and pool the results All of the above are legitimate approaches None of the above 14 Enzyme that cleaves DNA at sequence specific sites is called A B C D E DNA polymerase ligase restriction endonuclease sticky ends cDNA 15 DNA termini with overhangs produced by endonuclease digestion are called A B C D sticky ends blunt ends oligonucleotides none of the above 16 Which enzyme functions to polymerize DNA from an RNA template A B C D E DNA polymerase RNA polymerase Reverse transcriptase Ligase Endonuclease 17 Differing sizes of restriction fragments produced from the alleles of a gene constitute A B C D a southern blot an allozyme identification of a gene a restriction fragment length polymorphism 18 Which of the following is NOT a typical component of a polymerase chain reaction PCR reaction A B C D E Primer Ligase Template Taq DNA polymerase Buffer 19 Plasmids used in vitro to clone foreign DNA fragments are called A B C D E Transgenic cDNA Clones Vectors Conjugants 20 A restriction fragment containing a specific gene of interest can be identified by gel electrophoresis followed by transferring the DNA to a membrane as a solid support matrix using a procedure called A B C D a Southern blot an allozyme identification of a gene a restriction fragment length polymorphism 21 cDNA is A B C D chromosomal DNA which has been isolated from a donor organism complementary DNA that is generated by using reverse transcriptase to make DNA from mRNA cloned DNA that has been introduced into a cloning vector cut DNA that has been digested with a restriction endonuclease for use in a cloning experiment 22 The truth is that everyone has at least a handful of problem genes Which of the following factors would result in your genes never causing you trouble A B C D E if you only have some but not all of the genes that come into play to cause a particular disease if your genes for disorders don t express themselves strongly if our genes for disorders are recessive and you inherit only one copy all of the above none of the above Short Answer variable points 2 pts The restriction endonuclease HindIII which cuts at the sequence AAGCTT cuts the genome of the bacteriophage lambda approximately 50 kilobases in size into 7 fragments The enzyme RsaI which cuts at the sequence GTAC cuts the lambda genome into 113 fragments Explain the reason for the difference in the number of cleavage sites for these two enxymes 2 pts List two conditions that need to be met for