Name___________________ Date__________________ Instructor name______________________ Module 18 – Polymerase Chain Reaction - Worksheet 1. Which feature of Taq DNA polymerase makes it especially useful for PCR 2. Below are the first 600 base pairs of the mecA gene from Genbank 1 atgaaaaaga taaaaattgt tccacttatt ttaatagttg tagttgtcgg gtttggtata 61 tatttttatg cttcaaaaga taaagaaatt aataatacta ttgatgcaat tgaagataaa 121 aatttcaaac aagtttataa agatagcagt tatatttcta aaagcgataa tggtgaagta 181 gaaatgactg aacgtccgat aaaaatatat aatagtttag gcgttaaaga tataaacatt 241 caggatcgta aaataaaaaa agtatctaaa aataaaaaac gagtagatgc tcaatataaa 301 attaaaacaa actacggtaa cattgatcgc aacgttcaat ttaattttgt taaagaagat 361 ggtatgtgga agttagattg ggatcatagc gtcattattc caggaatgca gaaagaccaa 421 agcatacata ttgaaaattt aaaatcagaa cgtggtaaaa ttttagaccg aaacaatgtg 481 gaattggcca atacaggaac agcatatgag ataggcatcg ttccaaagaa tgtatctaaa 541 aaagattata aagcaatcgc taaagaacta agtatttctg aagactatat caaacaacaa Forward primer sequence: gtagaaatgactgaacgtccgataa Reverse primer sequence: ccaattccacattgtttcggtctaa Find the forward primer sequence on the mecA gene at position 178 and underline or highlight it. To identify the reverse primer sequence, first find the complementary sequence (A-T, G-C, etc) 5'-ccaattccacattgtttcggtctaa-3' ||||||||||||||||||||||||| 3'-_________________________-5' Now reverse it to write it from 5’ to 3’ 5'-_________________________-3' Search for this sequence on the mecA gene at position 463 in the mecA sequence and underline or highlight it Now calculate the predicted size of the PCR product by counting the number of bases between the primer pair (inclusive).3. During thePCR reaction, what happens at each temperature? a. 94°C b. 50°C c. 72°C 4. What is the purpose of ethydium bromide in the agarose gel when separating DNA fragments? 5. What is a major shortcoming when using PCR for diagnostic use?
View Full Document
Unlocking...