17.0147.014Lecture 16: Introduction to Lecture 16: Introduction to Ecology and the BiosphereEcology and the BiosphereMarch 11, 2005March 11, 2005BIOSPHEREATOMORGANISMPOPULATIONCOMMUNITYECOSYSTEMHierarchical Hierarchical Organization and Organization and EcologyEcologyCELLMOLECULE©©GBRMPA©©GBRMPA2GlacierBayAlaskaOne successionalpathway:Soils exposed less than 20 years:willow and DryasSoils exposed 45-80 years:sitka alder, scatteredcottonwoodSoils exposed 100years: sitka, alder,scattered spruceSoils exposed150-200 years:dense sitkaspruce andwestern hemlockGlacier BayDirection ofglacial retreat20 kmNFigure 50.12aYoungest CommunityYoungest CommunityOldest CommunityOldest CommunityNN22fixationfixation3Early-mid successional Late-mid successional ClimaxAlder – roots fix nitrogenSpruceHemlockFreeman Figure 50.12Primary Succession at Glacier Bay300200100YearYoungest MoraineOldest Moraine1 50 100 150 200In mineral soilIn forest floorNitrogen Concentration(g per m2of surface)NitrogenaseenzymeNN ≡NN ≡Substrate, N2Binding of Substrate+ 2HNN =NN−+ 2H+ 2HNNFree Nitrogenase can bind another molecule of N2Release of ProductReductionReduction ReductionHH HHHHProduct: Ammonia, NH3NHHHNHHHNitrogen FixationAdapted from: LIFE: The Science of Biology. Purves, Orians, and Heller, 20014Industrial N fixation 100140biologicalfixation200denitrificationSOILATMOSPHEREOCEANS15biologicalfixation110denitrification1200internal cycling8000internal cycling10burial36river flowgroundwaterThe Global Nitrogen CycleGigatons yr-1<3fixation bylightening1 1 GtGt““gigatongigaton””= 10= 1099tonton= 10= 101515gg= 1 billion = 1 billion Industrial N fixation 100140biologicalfixation200denitrificationSOILATMOSPHEREOCEANS15biologicalfixation140denitification1200internal cycling8000internal cycling?burial?river flow<3fixation bylighteninggroundwaterNitrogen “Cycle” Without Microbes5Life on Earth Today: AbridgedLife on Earth Today: Abridged(Photosynthesis = Respiration)(Photosynthesis = Respiration)CO2+ H2Ocarbon waterdioxide gas“CH“CH22O” +O” +OO22organicorganicoxygen oxygen carboncarbon(mass)(mass)Plants PhytoplanktonAnimals BacteriaChemical energy or heatRespirationPhotosynthesisSolar energySolar energyN,P,S,Fe….PhotosynthesisRespirationGlucose2 NADH2 ATP2 PyruvateCytoplasmMitochondrion2 NADH2 CO22 Acetyl CoAKrebscycle2 ATP4 CO26 NADH2 FADH2Glucose3 CO2PhotonCALVIN CYCLE2H2O4H++ O24e–ATPPhotosystem I4e–4e–2 NADPH2 NADP++ 2H+Photosystem II3 ATP3 ADP6 ADP6 ATP6 NADP++ 6H+6 NADPHFreeman, Figures 6.9, 7.10a, and 7.13Freeman, Figures 6.9, 7.10a, and 7.136BiologicalPumpCirculationGeological ReservoirPhotosynthesisGas exchange between air and oceanNet accumulationin oceanRespirationLand usechangesCombustionAfter Post et al., 19985.3100-1200.6-2.690-1201.6-2.4100-115100-115GtC yr-1The Global Carbon cycleThe Global Carbon cycle7COCO2 2 Concentration in Atmosphere (parts per million)Concentration in Atmosphere (parts per million)YearYearP>RP>RR >PR >PEmergent PropertyEmergent PropertyEARLYEARLYLife on Earth: AbridgedLife on Earth: Abridged(Photosynthesis > Respiration)(Photosynthesis > Respiration)CO2+ H2Ocarbon waterdioxide gas“CH“CH22O” +O” +OO22organicorganicoxygen oxygen carboncarbon(mass)(mass)Plants PhytoplanktonAnimals BacteriaChemical energy or heatRespirationPhotosynthesisSolar energySolar energyN,P,S,Fe….843210Formation of Earth4.5 billion years agoChemical evolutionPhotochemical synthesisEukaryotesEubacteriaArchaebacteriaProkaryotesOxygenic phototrophs(cyanobacteria)Development ofozone shieldModern eukaryotesMetazoansDinosaursCarbon burialToday: Release offossil carbon00.1%01%10%20%21%% O2inatmosphereBillions of years before presentMarineoriginBanded ironformationsTerrestrial originRed bedsOrigin of life –3.8 billion years agoAnoxygenicphototrophs(photosyntheticbacteria)Adapted from Brock and Madigan, Biology of MicroorganismsCO2+ H2O “CH2O” + O2↑Banded iron Banded iron formationsformationsRed bedsRed bedsFreeman Textbook Figure 25.7Absorption of Oxygen Released to Primitive AtmosphereFeFe2+2++ O+ O2 2 →→FeOFeO33Oceanic originOceanic originTerrestrial originTerrestrial origin9Present Day Planetary Atmospheres Mars Earth Venus CO2 95 % 0.035 % 98 % N2 2.5 % 78 % 2 % O2 0.25 % 21 % Trace H2O 0.1 % 1 % 0.05 % Temp (°C) -53 16 474 Adapted from Slesinger, W. 1991. Biogeochemistry: An Analysis of Global Change. Academic Press. P.34 The same processes operate at all scalesThe same processes operate at all scales““Ecosphere”Ecosphere”O2CO2CO2N,P,S,Fe….GLUCOSE OXIDATIONGlucose2 NADH2 ATP2 PyruvateCytoplasmMitochondrion2 NADH2 CO22 Acetyl CoAKrebscycle2 ATP4 CO26 NADH2 FADH2Glucose3 CO2PhotonCALVIN CYCLEIn the Z scheme, electrons flow from water to NADPH. 2H2O4H++ O24e–ATPPhotosystem I4e–4e–2 NADPH2 NADP++ 2H+Photosystem II3 AT P3 ADP6 ADP6 AT P6 NADP++ 6H+6 NADPHGLUCOSE OXIDATIONGlucose2 NADH2 ATP2 PyruvateCytoplasmMitochondrion2 NADH2 CO22 Acetyl CoAKrebscycle2 ATP4 CO26 NADH2 FADH2Glucose3 CO2PhotonCALVIN CYCLEIn the Z scheme, electrons flow from water to NADPH. 2H2O4H++ O24e–ATPPhotosystem I4e–4e–2 NADPH2 NADP++ 2H+Photosystem II3 AT P3 ADP6 ADP6 AT P6 NADP++ 6H+6 NADPHBiosphereBiosphereCellCell10Molecular EcologyMolecular EcologyViewing the BiosphereViewing the Biosphereas a network of genesas a network of genesA Sea of A Sea of OrgansimsOrgansimsA Network of GenesA Network of Genes(“dissolved information”)(“dissolved information”)Is…aaggttttaaaattaaggttttccccttaaaattccccttaaaattttccccttaaaattaaccccttaaaattaaggttttccaaggttccttaaaattaaggttttccaattaaggttttaaaattaaggttttccccttttaaggttttccccttaaaattaaggttccttaaaatt1 billion microbes per liter 99.9 % have not been cultivated information content of 1 liter = that in human genome most of unknown function11Craig VenterWired MagazineAugust 2004Scorcerer II Expedition12Challenger Expedition132 April 2004 Science2 April 2004 Science1.2 million new genes1.2 million new genes1800 new ‘species’1800 new ‘species’Craig Venter Takes on the ChallengeEstimated genetic inventory of Estimated genetic inventory of the planet: 20the planet: 20--30 billion genes.30 billion genes.Most of them microbialMost of them microbialTake Home Messages¾ Ecology – life at different scales¾ Emergent Properties¾ Organism ↔ Environment TWO WAY¾ Life has shaped Earth’s features¾
View Full Document