7 014 Quiz I Handout Quiz II announcements Quiz I Wednesday April 12 12 05 12 55 Walker Gym 3rd floor room 50 340 This will be a closed book exam Quiz Review Session Tuesday April 11 7 00 9 00 pm room 34 101 Open Tutoring Session Monday April 10 4 00 6 00 pm room 66 154 Below is a compilation of quiz problems from the last two years that cover material on our Quiz II solutions at the end There is some difference in covered material and emphasis on various parts of the material between last year s and this year s versions of the course We do not guarantee that this year s quiz will cover the exact same subtopics Question 1 29 points You discover extraterrestrial life forms whose genetic material behaves very much like Earth DNA Below are the structures of an alien nucleotide X and the earth DNA nucleotide cytosine C X S O O O O O S O O S O O O NH2 NH2 N O O P O O O P O O O P O N O O OH a For both structures i box the sugar ii circle the base iii underline the part of the structure used to power the addition of the nucleotide onto the growing chain b For the DNA nucleotide i label the 5 end ii label the 3 end iii draw an arrow to the part of the molecule that identifies it as a nucleotide used in DNA rather than in RNA 2 Question 1 continued c You replace the cytocine nucleotide with the following molecule in your DNA replication reaction but the reaction does not proceed Why NH2 N O O P O O O P O O O P N O O O H H d In bacteria DNA polymerase is capable of elongating DNA at the rate of 1000 nucleotides sec You isolate a mutant strain of bacteria strain P where the mutant DNA polymerase elongates DNA at 1250 nucleotides sec Assuming that the mutation is in the tenth codon what type of mutation most likely resulted in this mutant DNA polymerase a single base pair substitution or an insertion of one base pair Explain e Strain P is also deficient in histidine His biosynthesis You have two other strains that are deficient in His biosynthesis and only His biosynthesis 1 and 2 You grow the strains 1 2 and strain P on petri plates with minimal solid media Below is a schematic of what you found Circle the plate that represents the one containing the P strain Explain your answer 3 Question 2 30 points a Transcription i is the process that transfers information from to ii in eukaryotic organisms transcription occurs in the Nucleus Ribosome Membrane b Translation i is the process that transfers information from to ii in eukaryotic organisms translation occurs in the Nucleus Ribosome Membrane The following sequence of DNA encodes a hypothetical polypeptide called Playdo in a hypothetical bacteria E hypotheticus Transcription starts at and includes the C G base pair in bold The underlined T A base pair indicates the terminator 5 TTCCCCTATGGATGGTCATCTACGATGCCCCCATCACTAAAGCTTG 3 3 AAGGGGATACCTACCAGTAGATGCTACGGGGGTAGTGATTTCGAAC 5 c What are the first 6 bases of the transcribed RNA Be sure to label the 5 and 3 ends d What are the first 3 amino acids of the subsequent polypeptide Be sure to label the N and C termini e How many total amino acids are encoded in this polypeptide You identify a strain of bacteria containing a mutant tRNA that is capable of adding a tryptophan residue when it recognizes the codon UAG in the mRNA f What is the sequence of the anticodon of the mutant tRNA Be sure to label the 5 and 3 ends 4 Question 2 continued longer g The Playdo polypeptide would be the same length in the presence of the mutant tRNA shorter Why You isolate a mutant bacteria with the Playdo gene sequence below The bold boxed G C base pair is the site of the only difference between wild type and mutant Playdo a substitution of a G C base pair for a A T base pair As before the bold C G base pair indicates the start of transcription and the underlined T A base pair indicates the terminator 5 TTCCCCTATGGGTGGTCATCTACGATGCCCCCATCACTAAAGCTTG 3 3 AAGGGGATACCCACCAGTAGATGCTACGGGGGTAGTGATTTCGAAC 5 h What is the effect of this substitution on the peptide i Do you expect this peptide to have the same function as the wild type bacterial peptide Why or why not Intrigued by Playdo you search for a similar protein in mice by looking for similar DNA sequences in the mouse genome You find a gene that matches bacterial Playdo almost perfectly but contains a 36 DNA base pair insertion in the center of it When you purify the Playdo polypetide from mouse cells you are shocked to learn that mouse Playdo is the same length in amino acids as bacterial Playdo j Explain how is it possible that mouse Playdo and bacterial Playdo are the same polypeptide length even though they have substantially different gene lengths k Do you expect bacterial and mouse Playdo to have the same promoter and terminator sequences Why or why not 5 Question 3 25 points a Which of the following could alter gene regulation circle all that apply i Deleting a promoter ii Moving a yeast culture to a new food source iii Raising the temperature of a bacterial culture iv Mutating a repressor gene such that the resulting protein no longer functions The B operon contains the genes involved in the breakdown of sugar B in the bacteria E fake Sugar A is the preferred sugar in E fake In the absence of sugar A E fake can also use sugar B The B operon is subject to both negative and positive regulation b Indicate with a Low or a High the expected level of B operon expression when E fake cells are grown in the presence or absence of the sugars A and or B B operon expression Sugar A only Sugar B only Below is the diagram of the B operon B R encodes B Repressor the repressor of the B XYZ genes Ter sequences denote transcription terminators P sequences denote promoters O denotes an operator and Enh an enhancer Recall that the B operon is subject to both negative and positive regulation PR B R TerR Enh PXYZ O B X B Y B Z TerXYZ c How many in frame translation stop signals stop codons are present in the mRNA transcript originating with PXYZ d To which element does the B Repressor protein bind e What is the effect of the B Repressor binding on i transcription of B XYZ decrease no change increase ii translation of any B XYZ transcripts already made decrease no change increase 6 Question 3 continued You have isolated three loss of function mutants in the B operon f For each mutant in the table below for each condition indicate with a Yes or a No whether the repressor protein and the activator protein are each bound to their respective …
View Full Document