Recitation Section 6Molecular Biology—DNA as Genetic Material and DNA RepresentaA. DNA as Genetic MaterialRecitation Section 6 March 1-2, 2006 Molecular Biology—DNA as Genetic Material and DNA Representations A. DNA as Genetic Material By the end of this section, we will solve the following problem. Ken Chi, a researcher in the lab working on the bird flu virus, has a cold. Inadvertently, he sneezes in the general vicinity of an open tissue culture plate with the chicken cells infected with bird flu. You are his bay mate, and you think to yourself that this may be a bad idea. Ken, however, forgets all about it until a week later he performs a control on his experiment by trying to infect human cells with the virus isolated from his chicken culture. Surprisingly, a small percentage of human cells become infected and proceed to produce bird flu virus particles that then infect other cells in the culture. This is significant because this particular strain of bird flu has not been able to infect a human yet. Ken thinks that he may have inadvertently stumbled onto a new mutation in the bird flu virus that would allow it to infect humans, and that he needs to immediately sequence all of the virus’s genome to find out what the mutation is. He is reasoning that such mutation can also occur naturally in birds infected with the bird flu, and that all the health officials would need to know what to look for in new cases of the virus. But you think that there is a much more plausible explanation for Ken’s results, and you remind him about that sneeze. Ken agrees that your hypothesis is worth checking out, so he decides to perform an experiment to determine whether you are right. In that experiment, he looks for a particular section of genetic material in the newly isolated bird flu virus. a) What does that section of genetic material encode? b) If you are right, what sequence of events led to the new variant of the bird flu virus being able to infect human cells? c) If you are right, is there another type of virus that may be found in the original chicken tissue culture? If yes, what is it and is it dangerous? If not, explain why not. d) To date, only some cases of bird to human transmission of the virus have been recorded. No subsequent human to human transmissions have been recorded. Explain why the bird flu may be able to infect some humans when transitioning from birds, but may not be then able to infect other humans by transitioning either directly from a bird or from the infected human. e) Explain how a scenario similar to the one we just discussed may occur in nature. But before we tackle this problem, we will review some key ideas. Before people used words such as “genetic material,” the concept behind this term was well established. In fact, an entire industry based in large part on this concept played an enormous role in the development of our civilization.1. What is this industry? How was the concept of “genetic material” central, if not articulated, part of this industry? After the work of Mendel was re-discovered, trying to understand what that “genetic material” was became a key part of scientific endeavor. While scientists did not discover what that substance was for some time, they fairly quickly formulated the three requirements that genetic material must satisfy. 2. What are those requirements? Why do they make sense? 3. Given what you now know about DNA structure, how does DNA satisfy these requirements? In 1920s, Frederick Griffith experimented with smooth and rough Streptococcus pneumoniae bacteria. Griffith found that contrary to expectations, infecting a mouse with a mixture of live rough bacteria of type II (RII) and heat-killed smooth bacteria of type III (SIII), killed the mouse. Griffith concluded that something was transferred in the course of the experiment from one type of bacteria to another, and as a result transformed the recipient bacteria. He named that substance “transforming principle.” In fact, Griffith was able to isolate virulent bacteria from the dead mouse. 4. What was transferred in the experiment? 5. What type of bacteria was the recipient of the transforming principle, and what type was the “sender?”6. How did the transfer enable the appearance of virulent bacteria? 7. Were all the bacteria of the recipient type transformed? Describe the probable process from co-infection to the death of the mouse. Now back to the problem we posed on page 1. a) What does that section of genetic material encode? b) If you are right, what sequence of events led to the new variant of the bird flu virus being able to infect human cells? c) If you are right, is there another type of virus that may be found in the original chicken tissue culture? If yes, what is it and is it dangerous? If not, explain why not. d) To date, only some cases of bird to human transmission of the virus have been recorded. No subsequent human to human transmissions have been recorded. Explain why the bird flu may be able to infect some humans when transitioning from birds, but may not be then able to infect other humans by transitioning either directly from a bird or from the infected human.e) Explain how a scenario similar to the one we just discussed may occur in nature. B. DNA Representations DNA is a long polymer of nucleotides that only differ in their nitrogenous bases. Yet it encodes a lot of information. 1. What are some of the types of information encoded in DNA? 2. How is it possible to reliably encode these many types of information in DNA? Over the course of the Molecular Biology unit, we will encounter a number of different representations of DNA. While you may not be able to recognize what each representation means right now, it is important that you are able to do that by the end of the unit. a b c d e 5’ 3’ 3’ 5’ 5’AACGCAAGGCACTTCACCAGGCTTGTATATATAAATGTCGTGATGCTTCTATGCCAAAGTAAAAGGCAACACTTGAAGATTTCGTTGTAGGCC3’ f 3’TTGCGTTCCGTGAAGTGGTCCGAACATATATATTTACAGCACTACGAACATACGGTTTCATTTTCCGTTGTGAACTTCTAAAGCAACATCCGG5’ PA+ A+ N- PN+ PXYZ+ O+ g PA+ A+ N+ PN+ PXYZ+ O+ h PA+ A- N+ PN+ PXYZ+ O+i j H 1. In figure e, what do vertical lines represent? 2. For the figures you can classify, how do all these representations relate to each
View Full Document
Unlocking...