17.0147.014Lecture 1: Introduction to Lecture 1: Introduction to Ecology and the BiosphereEcology and the BiosphereFeb. 7 2007Feb. 7 2007BIOSPHEREATOMORGANISMPOPULATIONCOMMUNITYECOSYSTEMHierarchical Hierarchical Organization and Organization and EcologyEcologyCELLMOLECULE©©GBRMPA©©GBRMPA2GlacierBayAlaskaOne successionalpathway:Soils exposed less than 20 years:willow and DryasSoils exposed 45-80 years:sitka alder, scatteredcottonwoodSoils exposed 100years: sitka, alder,scattered spruceSoils exposed150-200 years:dense sitkaspruce andwestern hemlockGlacier BayDirection ofglacial retreat20 kmNFigure 50.12aYoungest CommunityYoungest CommunityOldest CommunityOldest CommunityNN22fixationfixation3Early-mid successional Late-mid successional ClimaxAlder – roots fix nitrogenSpruceHemlockFreeman Figure 50.12Primary Succession at Glacier Bay300200100YearYoungest MoraineOldest Moraine1 50 100 150 200In mineral soilIn forest floorNitrogen Concentration(g per m2of surface)NitrogenaseenzymeNN ≡NN ≡Substrate, N2Binding of Substrate+ 2HNN =NN−+ 2H+ 2HNNFree Nitrogenase can bind another molecule of N2Release of ProductReductionReduction ReductionHH HHHHProduct: Ammonia, NH3NHHHNHHHNitrogen FixationAdapted from: LIFE: The Science of Biology. Purves, Orians, and Heller, 20014Industrial N fixation 100140biologicalfixation200denitrificationSOILATMOSPHEREOCEANS15biologicalfixation110denitrification1200internal cycling8000internal cycling10burial36river flowgroundwaterThe Global Nitrogen CycleGigatons yr-1<3fixation bylightening1 1 GtGt““gigatongigaton””= 10= 1099tonton= 10= 101515gg= 1 billion = 1 billion Industrial N fixation 100140biologicalfixation200denitrificationSOILATMOSPHEREOCEANS15biologicalfixation140denitification1200internal cycling8000internal cycling?burial?river flow<3fixation bylighteninggroundwaterNitrogen “Cycle” Without Microbes5Life on Earth Today: AbridgedLife on Earth Today: Abridged(Photosynthesis = Respiration)(Photosynthesis = Respiration)CO2+ H2Ocarbon waterdioxide (gas)“CH“CH22O” +O” +OO22organicorganicoxygen oxygen carboncarbon(solid)(solid)Plants PhytoplanktonAnimals BacteriaChemical energy or heatRespirationPhotosynthesisSolar energySolar energyN,P,S,Fe….PhotosynthesisRespirationGlucose2 NADH2 ATP2 PyruvateCytoplasmMitochondrion2 NADH2 CO22 Acetyl CoAKrebscycle2 ATP4 CO26 NADH2 FADH2Glucose3 CO2PhotonCALVIN CYCLE2H2O4H++ O24e–ATPPhotosystem I4e–4e–2 NADPH2 NADP++ 2H+Photosystem II3 ATP3 ADP6 ADP6 ATP6 NADP++ 6H+6 NADPHFreeman, Figures 6.9, 7.10a, and 7.13Freeman, Figures 6.9, 7.10a, and 7.136BiologicalPumpCirculationGeological ReservoirPhotosynthesisGas exchange between air and oceanNet accumulationin oceanRespirationLand usechangesCombustionAfter Post et al., 19985.3100-1200.6-2.690-1201.6-2.4100-115100-115GtC yr-1The Global Carbon cycleThe Global Carbon cycle7COCO2 2 Concentration in Atmosphere (parts per million)Concentration in Atmosphere (parts per million)YearYearP>RP>RR >PR >PEmergent PropertyEmergent Propertyfrom SeaWiFs Project websiteAtmospheric Carbon Dioxide (Mauna Loa)Atmospheric Carbon Dioxide (Mauna Loa)WinterWinterR > PR > PSummerSummerP > RP > R8EARLYEARLYLife on Earth: AbridgedLife on Earth: Abridged(Photosynthesis > Respiration)(Photosynthesis > Respiration)CO2+ H2Ocarbon waterdioxide (gas)“CH“CH22O” +O” +OO22organicorganicoxygen oxygen carboncarbon(solid)(solid)Plants PhytoplanktonAnimals BacteriaChemical energy or heatRespirationPhotosynthesisSolar energySolar energyN,P,S,Fe….43210Formation of Earth4.5 billion years agoChemical evolutionPhotochemical synthesisEukaryotesEubacteriaArchaebacteriaProkaryotesOxygenic phototrophs(cyanobacteria)Development ofozone shieldModern eukaryotesMetazoansDinosaursCarbon burialToday: Release offossil carbon00.1%01%10%20%21%% O2inatmosphereBillions of years before presentMarineoriginBanded ironformationsTerrestrial originRed bedsOrigin of life –3.8 billion years agoAnoxygenic phototrophs(photosynthetic bacteria)Adapted from Brock and Madigan, Biology of MicroorganismsCO2+ H2O “CH2O” + O2↑9Banded iron Banded iron formationsformationsRed bedsRed bedsFreeman Textbook Figure 25.7Absorption of Oxygen Released to Primitive AtmosphereFeFe2+2++ O+ O2 2 →→FeOFeO33Oceanic originOceanic originTerrestrial originTerrestrial originPresent Day Planetary Atmospheres Mars Earth Venus CO2 95 % 0.035 % 98 % N2 2.5 % 78 % 2 % O2 0.25 % 21 % Trace H2O 0.1 % 1 % 0.05 % Temp (°C) -53 16 474 Adapted from Slesinger, W. 1991. Biogeochemistry: An Analysis of Global Change. Academic Press. P.3410Similar processes at all scalesSimilar processes at all scales““Ecosphere”Ecosphere”O2CO2CO2N,P,S,Fe….GLUCOSE OXIDATIONGlucose2 NADH2 ATP2 PyruvateCytoplasmMitochondrion2 NADH2 CO22 Acetyl CoAKrebscycle2 ATP4 CO26 NADH2 FADH2Glucose3 CO2PhotonCALVIN CYCLEIn the Z scheme, electrons flow from water to NADPH. 2H2O4H++ O24e–ATPPhotosystem I4e–4e–2 NADPH2 NADP++ 2H+Photosystem II3 AT P3 ADP6 ADP6 AT P6 NADP++ 6H+6 NADPHGLUCOSE OXIDATIONGlucose2 NADH2 ATP2 PyruvateCytoplasmMitochondrion2 NADH2 CO22 Acetyl CoAKrebscycle2 ATP4 CO26 NADH2 FADH2Glucose3 CO2PhotonCALVIN CYCLEIn the Z scheme, electrons flow from water to NADPH. 2H2O4H++ O24e–ATPPhotosystem I4e–4e–2 NADPH2 NADP++ 2H+Photosystem II3 AT P3 ADP6 ADP6 AT P6 NADP++ 6H+6 NADPHBiosphereBiosphereCellCellMolecular EcologyMolecular EcologyViewing the BiosphereViewing the Biosphereas a network of genesas a network of genes11A Sea of A Sea of OrgansimsOrgansimsA Network of GenesA Network of Genes(“dissolved information”)(“dissolved information”)Is…aaggttttaaaattaaggttttccccttaaaattccccttaaaattttccccttaaaattaaccccttaaaattaaggttttccaaggttccttaaaattaaggttttccaattaaggttttaaaattaaggttttccccttttaaggttttccccttaaaattaaggttccttaaaatt 1 billion microbes per liter 99.9 % have not been cultivated information content of 1 liter = that in human genome most of unknown functionCraig VenterWired MagazineAugust 200412Scorcerer II Expedition13Challenger Expedition 2 April 2004 Science2 April 2004 Science1.2 million new genes1.2 million new genes1800 new ‘species’1800 new ‘species’Craig Venter Takes on the ChallengeEstimated genetic inventory of Estimated genetic inventory of the planet: 20the planet: 20--30 billion genes.30 billion genes.Most of them microbialMost of them microbial14Take Home Messages¾
View Full Document
Unlocking...