Polymerization and SequenceReading AssignmentThe basicsBuilding MacromoleculesMajor Biological PolymersNucleic AcidsNucleotidesNucleotide PairingA segment of DNAComplementaritySequence CombinationsLong Sequences won’t match by chanceComparing DNA sequencesLong Similar SequencesProbing for a matchHuman Genetic UniquenessSeparating DNA by sizeRNA, another nucleic acidTypes of RNAFolding single strandsThe Central DogmaProteinsAmino acidsProtein FunctionProblemVocabularyLecture 6 Exam 1Lecture 6 Exam 1UIC BioS 101 NybergUIC BioS 101 Nyberg11Polymerization and SequencePolymerization and SequenceStorage of information and function are Storage of information and function are based on very large molecules based on very large molecules (macromolecules) built from sequentially (macromolecules) built from sequentially added subunits (each of which is a added subunits (each of which is a moderately sized molecule).moderately sized molecule).Lecture 6 Exam 1 UIC BioS 101 Nyberg 2Reading AssignmentReading Assignment►►I have assigned chapters 3 & 4 as the I have assigned chapters 3 & 4 as the reading for this lecture. There is a lot of info reading for this lecture. There is a lot of info in those chapters (in those chapters (most is also covered in most is also covered in BioSBioS 100100). ). ►►I recommend concentrating your studying I recommend concentrating your studying on the understanding the significance of the on the understanding the significance of the sequence order in nucleic acids and sequence order in nucleic acids and proteins.proteins.Lecture 6 Exam 1 UIC BioS 101 Nyberg 3The basicsThe basics►►Reading and storing biological information is Reading and storing biological information is done done linearlylinearly and and directionallydirectionally..►►Linear means that there are no branches or Linear means that there are no branches or switch points.switch points.►►There is a There is a beginningbeginning and an and an endend in in biological information expression.biological information expression.Lecture 6 Exam 1 UIC BioS 101 Nyberg 4Building MacromoleculesBuilding Macromolecules►►Biologically important macromolecules are Biologically important macromolecules are polymers built through linking of subunits, polymers built through linking of subunits, called called polymerization..►►In biological polymers the In biological polymers the order of the of the subunits (parts) is critical. Biological subunits (parts) is critical. Biological ‘‘informationinformation’’ is read is read linearlylinearly and and directionallydirectionally (like written language).(like written language).Lecture 6 Exam 1 UIC BioS 101 Nyberg 5Major Biological PolymersMajor Biological Polymers►►DNADNA and and RNARNA are nucleic acids that store are nucleic acids that store information in the information in the sequence of bases of bases attached to the attached to the ‘‘backbonebackbone’’ of a chain.of a chain.►►AA ProteinProtein is a specific sequence of amino is a specific sequence of amino acids linked together linearly. The sequence acids linked together linearly. The sequence of amino acids is known as the of amino acids is known as the primary structure of the protein.of the protein.Lecture 6 Exam 1 UIC BioS 101 Nyberg 6Nucleic AcidsNucleic Acids►►The The nucleotidenucleotide is the subunit of nucleic is the subunit of nucleic acids.acids.►►A single nucleotide has 3 parts:A single nucleotide has 3 parts:one Nitrogenous baseone Nitrogenous baseone 5 carbon sugarone 5 carbon sugarPhosphate (1 to 3)Phosphate (1 to 3)►►The subunits are linked together with a The subunits are linked together with a repeating sugarrepeating sugar--phosphate(phosphate(--sugarsugar-- phosphate) phosphate) ‘‘backbonebackbone’’..Lecture 6 Exam 1 UIC BioS 101 Nyberg 7NucleotidesNucleotides►►All nucleotides have a All nucleotides have a nitrogenous base attached to the sugar and a phosphate attached to the sugar and a phosphate attached to the sugar attached to the sugar at a different placeat a different place..►►The sugar in DNA is different than RNAThe sugar in DNA is different than RNADNA sugar is DNA sugar is deoxyribosedeoxyriboseRNA sugar is riboseRNA sugar is ribose►►The nitrogenous bases are of two types, The nitrogenous bases are of two types, purinespurines and and pyrimidinespyrimidines..Lecture 6 Exam 1 UIC BioS 101 Nyberg 8Nucleotide PairingNucleotide Pairing►►DNA has only four different nitrogenous DNA has only four different nitrogenous bases: Cytosine (bases: Cytosine (C) and Thymine () and Thymine (T) are ) are pyrimidinespyrimidines, Adenine (, Adenine (A) and Guanine () and Guanine (G) ) are are purinespurines..►►DNA is actually two very long molecules DNA is actually two very long molecules held together by many hydrogen bonds held together by many hydrogen bonds between a between a purinepurine on one on one strand and a and a pyrimidinepyrimidine on the other.on the other.►A pairs with pairs with T; ; G pairs with pairs with CLecture 6 Exam 1 UIC BioS 101 Nyberg 9A segment of DNAA segment of DNA►ATCGCTACATGATTAGCGATGTACTA a DNA double strandEach line represents consecutive bases in a strand Each line represents consecutive bases in a strand (=molecule) of DNA. The two strands are held (=molecule) of DNA. The two strands are held together by hydrogen bonds.together by hydrogen bonds.The strands have a The strands have a directiondirection when one looks at the when one looks at the chemical details. By convention the top strand is chemical details. By convention the top strand is 55’’ to 3to 3’’ and the bottom strand is therefore 3and the bottom strand is therefore 3’’ to 5to 5’’..Lecture 6 Exam 1 UIC BioS 101 Nyberg 10ComplementarityComplementarity►►Because of base pairing, knowing the Because of base pairing, knowing the sequence of one strand tells one the tells one the sequence of the other DNA strand, so often sequence of the other DNA strand, so often the sequence of only one is given (5the sequence of only one is given (5’’ to left). to left). ►►When the strands match they are said to be When the strands match they are said to be complementarycomplementary..►►The two strands of double stranded DNA will The two strands of double stranded DNA will separate (melt) when the temperature is separate (melt) when the temperature is raised (75 to 80raised