Lecture 36 Self assessment Transcription 3 a 5 ATCGGGCTAGCATCGGGCTAGCATCGGGCTAGC 5 b 3 TAGCCCGATCGTAGCCCGATCGTAGCCCGATCG 1 Please identify the following a Coding Strand b Template Strand 2 In this stage of transcription the DNA is unwound and the RNA polymerase with associated transcription factors is present at the promoter but nucleotides have not been polymerized as yet Initiation 3 Please explain the polymerase reaction and state the process that drives it forward The incoming alpha phosphate undergoes a nucleophilic attack by the 3 OH of the preceding nucleotide the phosphoanydride bond is made and pyrophosphate is given off as a leaving group 4 What effect does Topoisomerase II have on transcription assists inhibits 5 and how does it have this effect inducing removing negative supercoils 6 In prokaryotes the core RNA polymerase is made up of what subunits 2 7 Factor serves what purpose Provides specificity to the polymerase decreases core affinity for random DNA but at the same time allows the core to recognize specific promoter sequences 8 Please state the parts of a prokaryotic promoter necessary for attracting the RNA polymerase 10 and 35 regions and the intervening space You should know what a consensus sequence is what this means for promoter strength what recognizes the promoter 9 What is the reason for this spacing of these elements To optimally place the 10 and 35 regions into the binding spaces of the sigma factor for optimal DNA protein contatcts 10 What is it in eukaryotes that attracts the RNA polymerase to promoters in eukaryotes TFIID 11 The UP element is found where Upstream of the promoter of highly transcribed genes You should know what these genes were discussed in lecture 12 Which of the following are FALSE Choose all that apply a The UP element is part of the core promoter in highly expressed genes b TFIID Binds to the RNA polymerase itself c The taata box is rich in A and T dNTs which provide the flexibility necessary for this DNA region to wrap around and stabilize the polymerase at the promoter to increase the chances of initiation occurring d The UP element is a transcription factor in prokaryotes Lecture 36 Self assessment Transcription 13 Name two means by which termination in prokaryotes occurs a GC Stem loop Followed by polyA and polyU region b Rho factor mediated You should know how this works 14 Which of the following are true a Most prokaryotic mRNAs are usually post transcriptionally modified b Most prokaryotic RNAs are polycistronic one promoter serves to the transcription of an RNA which is comprised of several protein coding sequences c tRNAs in prokaryotes are transcribed in tandem and clipped from the larger RNA transcript d rRNAs and tRNAs in prokaryotes are transcriptionally modified 15 Concurrent transcription and translation of a gene can occur in prokaryotes eukaryotes 16 Please state the function of each Eukaryotic RNA polymerase a RNA Pol I transcribes rRNAs 5 8S 18S 28S b RNA Pol II transcribes mRNA precursors ans snRNAs c RNA Pol III transcribes tRNAs and rRNA 5S 17 Which of the following are true of TBP TBP a is found only in Pol II transcriptional initiation complexes b is symmetric c provides directionality for further transcription factors d provides directionality for transcription e bends DNA at the CAAT Box 18 Please name the members of the basal transcription Pol II complex TFIIA TFIIB TFIID TFIIE TFIIF TFIIH 19 Which of the following is FALSE a TBP is part of TFIID b TFIIA binds to TBP and stabilizes TBP binding at the promoter c TFIIA recruits RNA polymerase II with the help of TFIIF d TFIIH phosphorylates the Pol II C Terminal Domain e TFIIH contains a helicase and kinase necessary for promoter escape f TFIIE and TFIIH are both necessary for promoter escape 20 Please name the modifications present in eukaryotic mRNAs at the 3 and 5 ends 5 MethylGuanosine Cap and 3 Poly A tail you should know the functions of these structures 21 What is the signal in eukaryotes to stop mRNA transcription mRNA Cleavage Signal Lecture 36 Self assessment Transcription 22 RNA Pol I RNA Pol lI RNA Pol III in the nucleolus synthesizes a long transcript that will be modified and clipped to form rRNAs 23 The clipping process referred to in Q22 and splicing are the same process T F 24 What features of the mRNA are important for proper splicing 5 3 splice site sequence and adenylate branch point Please also know the process of splicing the type and process of the reactions and the actual catalyst also what disease discussed in lecture results from a splice site defect
View Full Document
Unlocking...