Slide 1Slide 3DNA SequencingSlide 5Slide 6Slide 8Making Multiple Copies of a Gene or Other DNA SegmentSlide 11Using Restriction Enzymes to Make a Recombinant DNA PlasmidSlide 15Slide 17Slide 18Slide 20Slide 22Expressing Cloned Eukaryotic GenesBacterial Expression SystemsEukaryotic DNA Cloning and Expression SystemsStudying the Expression of Single GenesSlide 30Slide 32Slide 33Studying the Expression of Interacting Groups of GenesSlide 35Determining Gene FunctionSlide 41Slide 42Cloning Plants: Single-Cell CulturesSlide 44Cloning Animals: Nuclear TransplantationSlide 46Reproductive Cloning of MammalsSlide 48Slide 50Faulty Gene Regulation in Cloned AnimalsStem Cells of AnimalsSlide 53Embryonic and Adult Stem CellsSlide 55Induced Pluripotent Stem (iPS) CellsSlide 59Slide 61Environmental CleanupAgricultural ApplicationsCAMPBELLBIOLOGYReece • Urry • Cain • Wasserman • Minorsky • Jackson © 2014 Pearson Education, Inc.TENTHEDITIONCAMPBELLBIOLOGYReece • Urry • Cain • Wasserman • Minorsky • JacksonTENTHEDITION20DNA Tools and BiotechnologyLecture Presentation by Nicole Tunbridge andKathleen Fitzpatrick© 2014 Pearson Education, Inc. Biotechnology is the manipulation of organisms or their components to make useful productsThe applications of DNA technology affect everything from agriculture, to criminal law,to medical research© 2014 Pearson Education, Inc.Concept 20.1: DNA sequencing and DNA cloning are valuable tools for genetic engineering and biological inquiryThe complementarity of the two DNA strands is the basis for nucleic acid hybridization, the base pairing of one strand of nucleic acid to the complementary sequence on another strandGenetic engineering is the direct manipulation of genes for practical purposes© 2014 Pearson Education, Inc.DNA SequencingResearchers can exploit the principle of complementary base pairing to determine a gene’s complete nucleotide sequence, called DNA sequencingThe first automated procedure was based on a technique called dideoxy or chain termination sequencing, developed by Sanger© 2014 Pearson Education, Inc.Figure 20.2(a) Standard sequencing machine(b) Next-generation sequencing machines© 2014 Pearson Education, Inc.Figure 20.3DNA(template strand)Primer Deoxyribo-nucleotidesDideoxyribonucleotides(fluorescently tagged)DNApolymeraseDNA (template strand)Labeled strandsDirectionof movementof strandsLongest labeled strandDetectorLaserShortest labeled strandShortest LongestTechniqueResults5′5′5′5′5′3′3′3′3′3′CTGACTTCGACAACTGACTTCGACAATGTTCTGTTdATPGCTGTTCTGTTCTGTTCTGTTCTGTTCTGTTGACTGAAGCTGTTACTGAAGCTGAAGTGAAGCTGTTGAAGAAGAGddATPdCTPddCTPdTTPddTTPdGTPddGTPP PPP PPGGLast nucleotideof longestlabeled strandLast nucleotideof shortestlabeled strandGACTGAAGCdddddddddddddddddd© 2014 Pearson Education, Inc. “Next-generation sequencing” techniques use a single template strand that is immobilized and amplified to produce an enormous number of identical fragmentsThousands or hundreds of thousands of fragments (400–1,000 nucleotides long) are sequenced in parallel This is a type of “high-throughput” technology© 2014 Pearson Education, Inc.Figure 20.4TechniqueGenomic DNA is fragmented.Each fragment is isolated witha bead.Using PCR, 106 copies of eachfragment are made, each attachedto the bead by 5′ end.The bead is placed into a well withDNA polymerases and primers.A solution of each of the four nucleotidesis added to all wells and then washed off.The entire process is then repeated.If a nucleotide is joined to a growing strand, PPi is released, causing a flashof light that is recorded.If a nucleotide is notcomplementary to thenext template base,no PPi is released, andno flash of light is recorded.The process is repeated until everyfragment has a complete complementarystrand. The pattern of flashes reveals thesequence.Results678543214-mer3-mer2-mer1-merATGCTemplate strandof DNAPrimer3′A3′5′5′TGCA TGC A TGC A TGCA TGCTemplatestrandof DNAPrimerDNApolymerasedATPdTTP dGTPdCTPPPiPPiCCCCAAAATTTGGGGCCCCAAAATTTGGGGCCCCAAAATTTGGGGCCCCAAAATTTGGGGA AAAC© 2014 Pearson Education, Inc.Making Multiple Copies of a Gene or Other DNA SegmentTo work directly with specific genes, scientists prepare well-defined DNA segments in multiple identical copies by a process called DNA cloningPlasmids are small circular DNA molecules that replicate separately from the bacterial chromosomeResearchers can insert DNA into plasmids to produce recombinant DNA, a molecule withDNA from two different sources© 2014 Pearson Education, Inc. Reproduction of a recombinant plasmid in a bacterial cell results in cloning of the plasmid including the foreign DNAThis results in the production of multiple copies of a single geneThe production of multiple copies of a single gene is a type of DNA cloning called gene cloning© 2014 Pearson Education, Inc.Figure 20.5Bacterium4321BacterialchromosomePlasmidGene insertedinto plasmidCell containing geneof interestRecombinantDNA (plasmid)Gene ofinterestDNA ofchromosome(“foreign” DNA)Plasmid put intobacterial cellRecombinantbacteriumHost cell grown in culture to form a clone ofcells containing the “cloned” gene of interestGene ofinterestProtein expressedfrom gene of interestCopies of geneGene for pest resistanceinserted into plantsProtein harvestedBasic researchand variousapplicationsHuman growth hormonetreats stunted growthGene used to alter bacteriafor cleaning up toxic wasteProtein dissolves blood clotsin heart attack therapy© 2014 Pearson Education, Inc. A plasmid used to clone a foreign gene is called a cloning vectorBacterial plasmids are widely used as cloning vectors because they are readily obtained, easily manipulated, easily introduced into bacterial cells, and once in the bacteria they multiply rapidlyGene cloning is useful for amplifying genes to produce a protein product for research, medical, or other purposes© 2014 Pearson Education, Inc.Using Restriction Enzymes to Make a Recombinant DNA PlasmidBacterial restriction enzymes cut DNA molecules at specific DNA sequences called restriction sitesA restriction enzyme usually makes many cuts, yielding restriction fragmentsThe most useful restriction enzymes cut DNAin a staggered way, producing fragments with “sticky ends”© 2014 Pearson Education, Inc. Sticky ends can bond with complementary sticky ends of other fragmentsDNA ligase is an enzyme that seals the
View Full Document
Unlocking...