Plant responses and gene expression Like all eukaryotic organisms plant responses to the environment ultimately involve changes at the molecular level Every plant cell has a copy of the genome two copies in the sporophyte but not all genes are on at any given time The control of gene expression is the key concept Plant responses and gene expression The Central Dogma of Molecular Biology Describes the flow of information in all cellular organisms Campbell 9th ed Figure 17 3 Signal DNA Cap NUCLEUS Chromatin Chromatin modification DNA unpacking involving histone acetylation and DNA demethylation Gene available for transcription Gene Transcription RNA Exon Primary transcript Intron RNA processing Tail mRNA in nucleus Transport to cytoplasm CYTOPLASM mRNA in cytoplasm Degradation of mRNA Translation Degradation of protein Polypeptide Protein processing such as cleavage and chemical modification Active protein Transport to cellular destination Cellular function such as enzymatic activity structural support Eukaryotic gene expression can be controlled at many points Campbell 9th ed Figure 18 6 Signal DNA Cap NUCLEUS Chromatin Chromatin modification DNA unpacking involving histone acetylation and DNA demethylation Gene available for transcription Gene Transcription RNA Exon Primary transcript Intron RNA processing Tail mRNA in nucleus Transport to cytoplasm CYTOPLASM mRNA in cytoplasm Degradation of mRNA Translation Degradation of protein Polypeptide Protein processing such as cleavage and chemical modification Active protein Transport to cellular destination Cellular function such as enzymatic activity structural support Not all RNAs encode proteins transfer RNAs tRNAs and ribosomal RNAs rRNAs help catalyze translation Many other non coding RNAs are involved in various forms of gene expression regulation Campbell 9th ed Figure 18 6 Signal DNA Cap NUCLEUS Chromatin Chromatin modification DNA unpacking involving histone acetylation and DNA demethylation Gene available for transcription Gene Transcription RNA Exon Primary transcript Intron RNA processing Tail mRNA in nucleus Transport to cytoplasm CYTOPLASM mRNA in cytoplasm Degradation of mRNA Translation Degradation of protein Polypeptide Protein processing such as cleavage and chemical modification Active protein Transport to cellular destination Cellular function such as enzymatic activity structural support microRNAs miRNAs Small 20 24nt non coding RNAs that regulate gene expression of selected target genes miRNA targeting enhances degradation and represses translation of target mRNA they are negative regulators of target gene expression Campbell 9th ed Figure 18 6 Production and function of microRNAs Figure 18 15 Hairpin miRNA 5 3 a Primary miRNA transcript miRNA Hydrogen bond Dicer miRNA protein complex mRNA degraded Translation blocked b Generation and function of miRNAs plant miRNAs in action Two rice varieties below with very different growth habits Oryza sativa ssp japonica variety Shaoniejing SNJ Oryza sativa ssp indica variety Taichung Native 1 TN1 Jiao et al 2010 Regulation of OsSPL14 by OsmiR156 defines ideal plant architecture in rice Nature Genetics 42 541 544 plant miRNAs in action The differences between SNJ and TN1 are caused by a single nucleotide change in a single gene OsSPL14 Position 847 in the TN1 gene is C but is A in SNJ Jiao et al 2010 Regulation of OsSPL14 by OsmiR156 defines ideal plant architecture in rice Nature Genetics 42 541 544 plant miRNAs in action This difference disrupts pairing between miR156 and the OsSPL14 mRNA in the SNJ allele This is enough to allow OsSPL14 to escape miRNA regulation in SNJ plants The escaped OsSPL14 mRNA encodes a protein that is a transcription factor it goes on to regulate many other genes involved in plant organ development Recall that in RNA there are four bases A U G and C and that A pairs with U while G pairs with C 5 GUGCUCUCUCUCUUCUGUCA 3 OsSPL14 TN1 3 CACGAGUGAGAGAAGACAGU 5 miR156 5 GUGCUAUCUCUCUUCUGUCA 3 OsSPL14 SNJ 3 CACGAGUGAGAGAAGACAGU 5 miR156 Jiao et al 2010 Regulation of OsSPL14 by OsmiR156 defines ideal plant architecture in rice Nature Genetics 42 541 544 plant miRNAs in action The extra OsSPL14 in SNJ plants ultimately causes lower tiller number and increased grain per pannicle desirable agronomic traits 5 GUGCUCUCUCUCUUCUGUCA 3 OsSPL14 TN1 3 CACGAGUGAGAGAAGACAGU 5 miR156 5 GUGCUAUCUCUCUUCUGUCA 3 OsSPL14 SNJ 3 CACGAGUGAGAGAAGACAGU 5 miR156 Jiao et al 2010 Regulation of OsSPL14 by OsmiR156 defines ideal plant architecture in rice Nature Genetics 42 541 544 Plant Hormones Hormone A small molecule which acts over long distance to alter growth physiology or metabolism systems Hormones in animals travel through circulatory Hormones in plants concept may require some revision some compounds have hormone like effect only Some compounds with which elicit hormone like responses are simple metabolites i e sucrose locally Plant Hormones Phototropism The tendency of stems and leaves to grow toward regions of higher light for instance the coleoptile of a growing grass shoot will bend toward the light Driven by differential cell expansion Plant Hormones Darwin s experiments 1880s Light is perceived at the tip of the coleoptile but bending occurs lower down Plant Hormones Boyes Jensen experiments 1900s A water soluble messenger moves from the tip to the site of curvature Plant Hormones Went s experiments 1926 Asymmetric distribution of a mobile growth promoting substance causes phototropism in grass coleoptiles This compound was named auxin from the greek auxein to increase Plant Hormones Auxin The most common natural form is indole acetic acid IAA Derived from the amino acid Tryptophan Plant Hormones Auxin Polar transport The shoot apical meristem is a major source of auxins Auxin is directionally pumped in one direction between parenchyma cells Image shows auxin efflux proteins yellow which pump auxin OUT of parenchyma cells note how these pumps are only on the basal sides of the cells Plant Hormones Auxin Acid growth Auxins stimulate acidification of the cell wall Acids stimulate expansins which loosen cross links in the wall Turgor pressure expands the cell Plant Hormones Auxin Other effects Inhibition of lateral bud outgrowth enforcing apical dominance the tendency of the highest tip of the shoot to exclusively grow Herbicide 2 4 dichlorophenoxyacetic acid 2 4 D A structural mimic of auxin Monocots rapidly degrade it but many eudicots succumb to overgrowth due to