Unformatted text preview:

Homework 1 Handed out 9 4 08 Due 9 11 08 For this homework you will need to do a bit of research online You ll have to look up IUB IUPAC codes for DNA ambiguity codes as well as conversion tables between amino acids and the corresponding codons genetic code Please list your bibliographic online library etc source for this information 1 What is the reverse complement of the following DNA sequences Note that the third sequence contains IUB IUPAC ambiguity codes representing sets of 2 or more nucleotides ACAGGATGTTCATAGGCATTCCTCAGACTACAGTC ACTTGCTAAGAATCTGATTCAGATTCTTAGCAAGT GGCATGTCWAGACCTAMCYGACTCVGTAGGCCATG 2 What is the amino acid sequence encoded in the following DNA sequence assume gene starts at the first start codon and ends at first stop codon TTCGAGGGGCATGTTTGTTGCTATGAATGATAATAAAACAATGCTTTTTATTCCGGGGGCAACCAATTAAGTAATTC Trivia this is a piece of one of the plague s Yersinia pestis toxic factors 3 Match the following amino acid sequence to the corresponding location in the DNA string shown below KLFALTAVALMG GTATGAAAAAACTAAAATTGTTTGCTCTTACAGCTGTAGCCCTAATGGGTGTTTCAGGTGTA Trivia this is a piece of a bacterial rhodopsin gene one of the genes involved in photosynthesis Until 2000 it was believed that only plants were capable of photosynthesis The discovery of bacterial rhodopsin was done computationally and is one of the advances made possible by genomic analysis 4 Define the following biological terms look them up on the Internet and write out a one sentence definition in your own words Frameshift mutation Silent mutation continued on next page 5 Write a simple parser for FASTA files Specifically write a program in your favorite programming language that reads in a FASTA file then identifies all records that contain more than 500 nucleotides and outputs their identifiers to the screen one per line Note for this assignment you are not allowed to use any of the publicly available bioinformatics libraries the entire code must be written using standard constructs from the programming language of your choice Note The code you write must compile and run on the glue machines Deliverables i Your source code ii The output obtained by running your code on the file afs glue umd edu class fall2008 cmsc 423 0101 public homework1 fa


View Full Document

UMD CMSC 423 - Homework #1

Documents in this Course
Midterm

Midterm

8 pages

Lecture 7

Lecture 7

15 pages

Load more
Loading Unlocking...
Login

Join to view Homework #1 and access 3M+ class-specific study document.

or
We will never post anything without your permission.
Don't have an account?
Sign Up

Join to view Homework #1 and access 3M+ class-specific study document.

or

By creating an account you agree to our Privacy Policy and Terms Of Use

Already a member?