Unformatted text preview:

CMSC423 Bioinformatic Algorithms Databases and Tools Data clustering Why data clustering What does this mean CMSC423 Fall 2009 2 Data clustering F4BT0V001CZSIM rank 0000138 x 1110 0 y 2700 0 length 57 ACTGCTCTCATGCTGCCTCCCGTAGGAGTGCCTCCCTGAGCCAGGATCAAACGTCTG F4BT0V001BBJQS rank 0000155 x 424 0 y 1826 0 length 47 ACTGACTGCATGCTGCCTCCCGTAGGAGTGCCTCCCTGCGCCATCAA F4BT0V001EDG35 rank 0000182 x 1676 0 y 2387 0 length 44 ACTGACTGCATGCTGCCTCCCGTAGGAGTCGCCGTCCTCGACNC F4BT0V001D2HQQ rank 0000196 x 1551 0 y 1984 0 length 42 ACTGACTGCATGCTGCCTCCCGTAGGAGTGCCGTCCCTCGAC F4BT0V001CM392 rank 0000206 x 966 0 y 1240 0 length 82 AANCAGCTCTCATGCTCGCCCTGACTTGGCATGTGTTAAGCCTGTAGGCTAGCGTTCATC CCTGAGCCAGGATCAAACTCTG F4BT0V001EIMFX rank 0000250 x 1735 0 y 907 0 length 46 ACTGACTGCATGCTGCCTCCCGTAGGAGTGTCGCGCCATCAGACTG F4BT0V001ENDKR rank 0000262 x 1789 0 y 1513 0 length 56 GACACTGTCATGCTGCCTCCCGTAGGAGTGCCTCCCTGAGCCAGGATCAAACTCTG F4BT0V001D91MI rank 0000288 x 1637 0 y 2088 0 length 56 ACTGCTCTCATGCTGCCTCCCGTAGGAGTGCCTCCCTGAGCCAGGATCAAACTCTG F4BT0V001D0Y5G rank 0000341 x 1534 0 y 866 0 length 75 GTCTGTGACATGCTGCCTCCCGTAGGAGTCTACACAAGTTGTGGCCCAGAACCACTGAGC CAGGATCAAACTCTG F4BT0V001EMLE1 rank 0000365 x 1780 0 y 1883 0 length 84 ACTGACTGCATGCTGCCTCCCGTAGGAGTGCCTCCCTGCGCCATCAATGCTGCATGCTGC TCCCTGAGCCAGGATCAAACTCTG CMSC423 Fall 2009 3 Data clustering Given a collection of data points can we identify any patterns Data points DNA sequences Gene expression levels Organism abundances in an environment Vitals Patterns do certain points group together CMSC423 Fall 2009 4 Example 16S rRNA sequences from gut microbiome How many types of organisms are there Assumption organisms that are similar have similar 16S sequences Operational Taxonomic Unit sequences within 2 distance from each other Next step given OTU abundances for a number of patients do the patients cluster by age disease etc CMSC423 Fall 2009 5 Types of clustering algorithms Agglomerative Start with single observations Group similar observations into the same cluster Divisive All datapoints start in the same cluster Iteratively divide cluster until you find good clustering Hierarchical Build a tree leaves are datapoints internal nodes represent clusters CMSC423 Fall 2009 6 Measures of goodness of clustering Homogeneity All points in a cluster must be similar Separation Points in different clusters are disimilar CMSC423 Fall 2009 7 Microarray gene abundance clustering Each gene can be viewed as an array of numbers expression of gene at different time points expression of gene in different conditions normal variants of a disease etc Each time point or tissue sample can also be viewed as an array of numbers expression levels for all genes Basic idea cluster genes and or samples to highlight genes involved in disease CMSC423 Fall 2009 8 Hierarchical clustering Need definition of distance between data points e g individual genes Some measures Euclidean distance Manhattan distance Pearson correlation 2 x y i i i D x y i x i y i D x y E x x y y D x y x y Angle between vectors centered Pearson correlation Clustering algorithm group together data points that are most similar repeat CMSC423 Fall 2009 9 Hierarchical clustering Key element how do you compute distance between two clusters or a point and a cluster UPGMA average neighbor average linkage average distance between all genes in the two clusters Furthest neighbor complete linkage largest distance between all genes in clusters Nearest neighbor single linkage smallest distance between all genes in clusters Ward s distance inter cluster distance is variance of inter gene distances CMSC423 Fall 2009 10 Hierarchical clustering cont Irrespective of distance choice algorithm is the same 1 compute inter gene cluster distances 2 join together pair of genes clusters with smallest distance 3 recompute distances to include the newly created cluster 4 repeat until all points in one cluster Output of program is a tree Cluster sets defined by cut nodes any subset of internal tree nodes defines a set of clusters the sets of leaves in the corresponding subtrees Choice of cut can be tricky usually problem specifi Note all this can be done easily in R CMSC423 Fall 2009 11 Example gut microbiome in children CMSC423 Fall 2009 12 k means clustering Goal split data into exactly k clusters Basic algorithm Create k arbitrary clusters pick k points as cluster centers and assign each other point to the closest center Re compute the center of each cluster Re assign points to clusters Repeat Another approach pick a point at and see if moving it to a different cluster will improve the quality of the overall solution Repeat CMSC423 Fall 2009 13 K means clustering K 2 CMSC423 Fall 2009 14 Other clustering approaches Principal component analysis Identify a direction vector V such that the projection of data on V has maximum variance first principal component repeat vector V V such that project of data on V has maximum variance Usually plot the first 2 or 3 principal components CMSC423 Fall 2009 15 Other clustering approaches Self organizing maps Neural network based approach Output layer of network are points in a low dimensional space Graph theoretic Points are connected by edges representing strength of connection e g similarity or dissimilarity Pick clusters such that number of similar edges spanning boundaries is minimized or number of dissimilar edges within each cluster is minimized Markov chain clustering basic idea a random walk through a graph will stay within a local strongly connected region CMSC423 Fall 2009 16 Self organizing map of genomes http www jamstec go jp esc esc publication journal jes vol 6 pdf JES6 22 Abe pdf CMSC423 Fall 2009 17 Questions Compare nearest farthest average and Ward s cluster distances in terms of how compact the resulting clusters might be CMSC423 Fall 2009 18


View Full Document

UMD CMSC 423 - Data clustering

Documents in this Course
Midterm

Midterm

8 pages

Lecture 7

Lecture 7

15 pages

Load more
Loading Unlocking...
Login

Join to view Data clustering and access 3M+ class-specific study document.

or
We will never post anything without your permission.
Don't have an account?
Sign Up

Join to view Data clustering and access 3M+ class-specific study document.

or

By creating an account you agree to our Privacy Policy and Terms Of Use

Already a member?