Unformatted text preview:

CMSC423 Bioinformatic Algorithms Databases and Tools Lecture 3 Molecular biology primer Writing bioinformatics software Polymerase chain reaction PCR 1 Denature 2 Anneal attach primer 3 Extend 4 Repeat CMSC 423 Fall 2008 2 How does PCR work 1 Start 1 double stranded molecule 1 Denature 2 singlestranded molecules 1 Anneal 2 single stranded molecules with primers attached 1 Extend 2 double stranded molecules one long L strand and one short S terminated at a primer CMSC 423 Fall 2008 2 Start 2 double stranded molecules L S L S 2 Denature 2 x L strands 2 x S strands 2 Anneal all strands with primers attached 2 Extend 2 double stranded molecules L S L S 2 double stranded molecules S SS S SS SS strand terminated at both ends with a primer 3 PCR Recurrences Ln Sn SSn of strands of each type at cycle n L n Ln 1 2 Sn Sn 1 Ln 1 Sn 1 2 2 n 1 O n SSn Sn 1 2 SSn 1 O 2n The sequence between the primers SS is amplified exponentially will quickly overtake the solution CMSC 423 Fall 2008 4 Quantitative PCR Measure of PCR cycles needed to reach a certain concentration of DNA depends on initial of molecules Used in diagnostics e g is this a random Anthrax spore from the environment or lots of spores from an attack CMSC 423 Fall 2008 http www dxsgenotyping com technology main htm 5 DNA sequencing Most techniques trick the polymerase into revealing the sequence The traditional method Sanger sequencing based on terminator bases prevent the polymerase from extending the DNA Sanger sequencing is essentially PCR terminator bases Other methods spy on the polymerase as it incorporates nucleotides CMSC 423 Fall 2008 6 Sanger sequencing Sanger F Coulson AR A rapid method for determining sequences in DNA by primed synthesis with DNA polymerase J Mol Biol 94 1975 G C A T A G G G TCTAATAGA AGATTATCTAACAGCTACCCTTCCATCA TCTAATT TCTAATTA TCTAATTAG TCTAATTAGA TCTAATTAGAT CMSC 423 Fall 2008from http www uvm edu cgep Education Sequence html pictures 7 The future of sequencing Single molecule sequencing current technology requires many copies of DNA being sequenced requires DNA amplification Massively parallel sequencing 100k sequencing reactions occuring at the same time Sequencing by synthesis Micro fluidics TCTAATAGA AGATTATCTAACAGCTACCCTTCCATCA CMSC 423 Fall 2008 http www genetics ucla edu sequencing pyro php http www usgenomics com8 The future of sequencing Massively parallel sequencing http arep med harvard edu each spot is a molecule or amplified from one molecule image processing used to track molecules during sequencing by synthesis often micro fluidics lab on a chip used 454 Life Sciences approx 60 Mbp in 200 bp reads 4 hr run Solexa Ltd approx 2 Gbp in 30 40 bp reads 3 day run ABI SOLiD 35bp reads 2 Gbp Helicos single molecule sequencing etc CMSC 423 Fall 2008 9


View Full Document

UMD CMSC 423 - Lecture 3 Molecular biology primer Writing bioinformatics software

Documents in this Course
Midterm

Midterm

8 pages

Lecture 7

Lecture 7

15 pages

Load more
Loading Unlocking...
Login

Join to view Lecture 3 Molecular biology primer Writing bioinformatics software and access 3M+ class-specific study document.

or
We will never post anything without your permission.
Don't have an account?
Sign Up

Join to view Lecture 3 Molecular biology primer Writing bioinformatics software and access 3M+ class-specific study document.

or

By creating an account you agree to our Privacy Policy and Terms Of Use

Already a member?