CMSC423 Midterm 10 7 2008 Name Honor Pledge The University of Maryland Code of Academic Integrity requests that you write by hand and sign the following statement pledging your commitment to academic integrity Please do so in the blank space below the text of the honor pledge I pledge on my honor that I have not given or received any unauthorized assistance on this examination Signature Please write your name on all additional sheets of paper you use NOTE Please budget your time carefully You only have 75 minutes available for this exam There is a very good chance you will not be able to answer all the questions in the allotted time though it is definitely possible to do that 1 20 points The basics a Define the term synonymous mutation b What is the central dogma of molecular biology c Reverse complement the following DNA string ATGCGGGCAC GGAAGCCGTG TACGCGAGCG CGCTTGAGGG d Identify the longest open reading frame in the following DNA sequence and translate it into an amino acid sequence note translation table provided at the end of the exam TGCGTATGTATGTCAGACGGTGAGACGCTTGCGGGCTAAGCGACG 2 20 points Given the following string construct a suffix tree including the suffix links GATATAGTAG Note this will be messy draw carefully Also no need to draw suffix links that point to the root of the tree 3 20 points Exact string matching a The steps outlined below represent an execution of the KMP algorithm text on top pattern on bottom i ABCABCDABABCDABDABDE X ABCDABD ii ABCABCDABABCDABDABDE X ABCDABD iii ABCABCDABABCDABDABDE X ABCDABD iv ABCABCDABABCDABDABDE ABCDABD In step i the pattern is matched until a mismatch occurs at the 4th character Since no suffix of the matched portion matches a prefix of the whole pattern no prefix and suffix of ABC match each other the pattern is shifted beyond the aligned region and the matching continues from the beginning of the pattern In ii a mismatch is found at position 7 in the pattern and the pattern is shifted iii so that the common prefix and suffix of the matched regions are aligned the first AB in the pattern is placed where the second AB matched at step ii The third position in the pattern is compared to the text and results in a mismatch The pattern is then shifted past this position and a match is found Using this execution as an example provide an argument why the overall running time of the algorithm proportional to the sum of the lengths of pattern and text b During the execution of the algorithm described in class for computing Z values when computing the value Z i we relied on the Z value for a position j i such that i Z j extends the farthest in the string j Z j is maximum over all choices of j i and ii j Z j i Would the algorithm still work efficiently linear time if only the second condition were satisfied Which part of the reasoning would fall apart Hint this is related to part a of this question 4 20 points Remember that a suffix tree is a compressed representation of all suffixes in a string such that each suffix is represented by a different leaf in the tree The least common ancestor of two nodes in a tree is the lowest node shared by the paths from the two nodes to the root Assume n is the least common ancestor of leaves i and j in a suffix tree for string S a What does this node represent b Describe an algorithm that will compute the Z values for S in O n time using the suffix tree assuming you are given function that allows you to compute the least common ancestor of any two nodes in constant time Reminder for any location i in S Z i is the longest prefix of S i n that matches a prefix S 5 20 points Suppose we have sequences v v1 vn and w w1 wm where v is longer than w We wish to find a substring of v which best matches all of w Global alignment won t work because it will try to align all of v Local alignment won t work because it may not align all of w The problem called the fitting problem can be formulated as the problem of finding a substring v of v that maximizes the score of alignment s v w among all substrings of v Give an algorithm which computes the optimal fitting alignment in O nm time Describe both how to compute the score of this alignment and how to compute the actual alignment Note You don t need to spell out all the details of the algorithm When using traditional dynamic programming approach it is sufficient to specify the initial conditions what values are written in the first row column of the matrix where will the score for this best alignment be located in the matrix and whether you use the global alignment recurrence in the algorithm max value between left diagonal and above or the local alignment recurrence that allows the alignment to restart at any location by taking the maximum of four values 0 and the three values mentioned above 6 BONUS 20 points In class we discussed two approaches to sequence alignment global and local alignment A global alignment requires the two sequences to be aligned end to end while a local alignment allows one to ignore any mismatches occurring at the end of the sequences There is however a middle ground the semiglobal alignment In a semi global alignment all characters in the two sequences must be aligned however only gaps internal to the alignment are counted while gaps at either end of the alignment are free For example the following sequences aligned optimally using global alignment CAGCACTTGGATTCTCCGG CAGC G T GG can be aligned optimally in a semiglobal fashion as follows CAGCA CTTGGATTCTCGG CAGCGTGG Describe a dynamic programming algorithm that computes the semiglobal alignment of two strings in time O mn The note in problem 5 applies here as well Translation table Ter stop codon TTT TTC TTA TTG F F L L Phe Phe Leu Leu TCT TCC TCA TCG S S S S Ser Ser Ser Ser TAT TAC TAA TAG Y Y Tyr Tyr Ter Ter TGT TGC TGA TGG C C W Cys Cys Ter Trp CTT CTC CTA CTG L L L L Leu Leu Leu Leu CCT CCC CCA CCG P P P P Pro Pro Pro Pro CAT CAC CAA CAG H H Q Q His His Gln Gln CGT CGC CGA CGG R R R R Arg Arg Arg Arg ATT ATC ATA ATG I I I M Ile Ile Ile Met ACT ACC ACA ACG T T T T Thr Thr Thr Thr AAT AAC AAA AAG N N K K Asn Asn Lys Lys AGT AGC AGA AGG S S R R Ser Ser Arg Arg GTT GTC GTA GTG V V V V Val Val Val Val GCT GCC GCA GCG A A A A Ala Ala Ala Ala GAT GAC GAA GAG D D E E …
View Full Document
Unlocking...