CMSC 423 Project Part 1 Multiple Sequence Aligner Due 11 59pm on November 16 2010 You will build a multiple sequence aligner In part 1 you ll implement the 2 approximation to MSA using affine gaps Rules You can work in groups of 2 The same grade will be assigned to both members of a group Do not use code from the internet or other groups Your code should be in Java or C If you choose to work in C the TA might not help debug C problems Part 1 Read in a scoring matrix file and a multi FASTA file and output the 2 approximation to the MSA under the sum of pairs score Format of the command Your program will be run using the following command msa score matrix in fasta out fasta Your program must run and compile on the glue umd edu machines Format of the multi FASTA file The multi FASTA file contains any number of sequences A sequence begins with a line containing a character in the first column Following the on the same line there is name for the sequence This name ends at the first space or at the end of the line whichever comes first Characters after the first space on this line are ignored Every name must be unique among the sequences in the file if you find a duplicate name report an error see below On the line after the line the sequence begins The sequence consists of any alphabetic character A Z a z Upper and lower case are distinct Spaces and newlines can be put anywhere in the sequence and should be ignored The sequence ends with either the start of another sequence or the end of the file Example multi FASTA file seq1 this text is ignored ACGTTTGAAATAGATACTGATCTGCATGACTAGACGAGTACGGGGGTATATATAAAAAA seq2 ACGTTTGAAATAG ATACTGATCTGCATGA CTAGACGAGTACGGGGGTATATATAAAAA A seq3 ATACTGAT CTGCATGA CTAGACGAGTACGGGGGTATATATAAAAA A Format of the scoring matrix file The file contains lines giving the cost of aligning two characters together Each line is of the format c1 c2 score where c1 and c2 are alphabetic characters or the gap character and where score is a floating point cost of aligning c1 to c2 The special case where c1 and c2 gives the gap opening cost the cost of starting a new gap The case where c16 and c2 gives the gap extension cost for pairing c1 with a gap The true cost of aligning a gap to a gap is always taken to be 0 The scores should be given with the understanding that the minimum cost alignment will be sought Example score matrix file 1 A T C G A A A A T T T C C G A T C G T C G C G G 10 5 5 5 5 5 2 5 2 5 2 5 5 2 5 2 5 5 2 5 5 Above the gap opening penalty is 10 the gap extension penalty is 5 no matter what the gap is aligned with The cost of a mismatch is 2 5 and the cost of a match is 5 Only one of c1 c2 and c2 c1 should be included in the scoring matrix If both are report an error as described below If a score needed by the input sequences is not defined report an error Format of the output Your computed MSA should be output as a multi FASTA file in the same format as described above except that now sequences are allowed to contain characters representing where the you have placed the gaps The filename for the output will be given on the command line You should also output the sum of pairs score on the terminal in the format SP score 50 where 50 is replaced by the actual computed SP score for the alignment you have computed You can and probably should output some informative messages to track the progress of your program Only the above line should start with SP score however Reporting errors If there is an error in the input FASTA file you should output the following error bad fasta file DETAILED MESSAGE HERE replacing the text DETAILED MESSAGE HERE with some short explanation of the error If there is an error in the scoring matrix or if some needed score is missing you should output the following error bad scoring matrix DETAILED MESSAGE HERE replacing the text DETAILED MESSAGE HERE with some short explanation of the error In either case your program should exit after printing the error message Submission Submit a zip file using the CS submit server submit cs umd edu The zip file must be named DIRID msa1 zip where DIRID is your UMD directory id The zip file should contain all of the files needed to compile and run your program If your program is written in Java it must be able to be compiled with javac java from the command line ensure this is true even if you use Eclipse If your program is written in C C it must be able to be compiled with the command make The TA will spend no more than 1 minute attempting to compile your program 2
View Full Document
Unlocking...