Unknown insert PCR analysis Reverse primer Forward primer Reverse primer kan cat Forward primer Forward primer 5 AAAAGGATCCAGG CTG GAG CTG CTT CG 3 Reverse primer 5 GGGGGGATCCATGGTCCATATGAATATCCTCCTTAG 3 PCR can be a useful tool to identify the unknown insert gene The primers listed above are designed to recognize both kan and cat genes Think about the directionality of the primers Which side has the 5 end 3 end Which strand are the primers annealing on Unknown insert PCR analysis Reverse primer Forward primer Reverse primer kan cat Forward primer Size of the inserts kan 1478 bp cat 1015 bp However because the primers anneal slightly within the inserts the PCR fragment sizes are slightly smaller than original size kan 1472 bp cat 1009 bp Unknown insert PCR analysis kan Reverse primer Forward primer Reverse primer cat Forward primer For the unknown insert identification project you may not use the unknown insert DNA given to you at the beginning of experiment as the template DNA for performing PCR What could you use instead as the template DNA for performing PCR Unknown insert restriction digestion analysis NdeI 1468 BamHI 0 PstI 605 BamHI 1478 kan 1478 bp cat 1015 bp BamHI 0 NdeI 1005 BamHI 1015 For the unknown insert identification project you may not digest the unknown insert DNA given to you at the beginning of experiment What could you use instead for the restriction digestion Additionally does the orientation of the insert forward vs reverse in the vector plasmid affect the fragment sizes after restriction digestion
View Full Document
Unlocking...