MCB 250 Discussion Week 5 Sept 28 Oct 3 Fall 2023 1 A promoter for an E coli gene that is transcribed by a 70 RNA polymerase has the following sequence 30 20 10 1 5 GGCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGA 3 CCGAAATGTGAAATACGAAGGCCGAGCATACAACACACCT The transcription start site 1 is identified a Identify the 10 and 35 sequences How close are they to the consensus 10 and 35 sequences b What is the spacing between the 10 and the 35 sequences How does this compare with the consensus spacing c The sequence of bases in a transcribed RNA is identical except for U s instead of T s to the non template strand Explain d Define promoter strength e Predict the effect of the following mutations on the strength of this promoter stronger weaker no change The changes indicated show the sequence as top strand complementary strand 1 Replacement of CTT GAA at 23 to 20 with AAG TTC 2 Replacement of G C at 9 with A T 3 Replacement of T A at 12 with C G 4 Replacement of G C at 38 with C G 5 Insertion of AT TA between 18 and 17 1 2 Alternative splicing is a key feature of the eukaryotic transcription translation process a In eukaryotes alternative splicing of pre mRNAs can result in the production of many structurally distinct proteins from information encoded in a single gene Explain b Do lower eukaryotes such as yeast Saccharomyces cerevisiae have the same opportunity to use alternative splicing to generate a vast array of proteins from a single gene Explain c What other events can lead to additional diversity in the repertoire of proteins that could be encoded by a single gene Hint think of the N and C terminal ends What about a post translational mechanism Name one 2 3 Compare and contrast transcription termination in bacteria and eukaryotes a What sites signal the transcription complex to terminate in prokaryotes and to terminate polyadenylate in eukaryotes b What proteins if any bind to these sites and what do they do c What determines the 3 end of the message d When does Pol II really terminate transcription 3 4 Compare and contrast rRNA processing and splicing 5 RNA structure a In general terms compare the structure of tRNA and the 16s rRNA b What are the driving forces that lead to these structures c Why do these structures tolerate non canonical base pairs G U A A etc when such base pairs are not found in DNA 6 To make an mRNA transcript from a gene the RNA polymerase needs to know where to start and to stop What are the signals and proteins involved in initiating and terminating RNA polymerase activity in E coli 4 This question comes from Week 6 worksheet Question 1 After the rearrangement Week 5 focuses on transcription and week 6 will focus on translation 5
View Full Document