MCB 250 Fall 2023 Discussion Worksheet Week 6 Oct 5 10 1 Aminoacyl tRNA synthetases have also been called amino acid activating enzymes a In what sense do these enzymes activate amino acids b Aminoacyl tRNA synthetases must recognize several different substrates What are they 2 The following is the DNA sequence of a gene encoding a small protein AACGATGCCATCAGAGCCCAGGACGTGATTTAA TTGCTACGGTAGTCTCGGGTCCTGCACTAAATT C a Assume that transcription proceeds from the left to right and begins at the first base shown Also assume translation requires an initiation codon and begins at the first one encountered what is the protein sequence encoded by the above mRNA Label the N and C termini See the codon table at the end 1 b Suppose that a C becomes mistakenly inserted into the position indicated between A and G due to a mistake during replication What will be the sequence of the protein now c Suppose that an additional two G s become inserted into the mutant gene in c above at the position shown between A and G What will the sequence of the protein be now 2 3 Briefly explain the initiation and elongation steps during translation in E coli 3 4 DNA repair mechanisms A What are the common themes for the major DNA repair mechanisms B What are the health consequences of inherited mutations in DNA repair pathway proteins Can you name a couple mentioned in class Are there others that you know of 4
View Full Document
Unlocking...