1Biol 3301: GeneticsExam #2October 24, 2001This exam consists of 28 questions worth a total of 100 points. The point total for each question is shown inparenthesis. Partial credit can be earned, so show your work. Good luck.Name____________________________________ SS#_____________________________________NOTE: THIS EXAM ALSO COVERED MICROBIAL GENETICS, SO THOSE QUESTIONS HAVE BEENREMOVED.1. (3) The molecule shown at the right is a ______a________.a) Purine ribonucleotide monophosphate PO3 – CH2 0b) Pyrimidine deoxynucleotide monophosphatec) Pyrimidine dideoxynucleotide monophosphate H Hd) Purine deoxynucleotide monophosphate H He) Pyrimidine ribonucleotide monophosphate OH OH2. (3) If a piece of double stranded DNA has an guanine content of 26%, what proportion of thymine do youexpect?a) 24% b) 25% c) 26% d) 0% e) 48% Answer - a3. (6) During the initiation of DNA synthesis, helicase __unwinds____ the double strand DNA helix,SSBP maintains unwound DNA in a ____single-stranded____ form, and primase lays down__RNA___ primers used to initiate DNA synthesis.4. (6) Weak base pairing is seen between __Adenine__ and ____Thymine_____ because only ___2______hydrogen bonds are formed, whereas strong base pairing is seen between ___cytosine___ and______guanine_______ because ____3______ hydrogen bonds are formed.5. (4) A ß-pleated sheet is an example of a: Answer - da) Alternative DNA structure b) Protein tertiary structure c) Mutant ß-globin proteind) Protein secondary structure e) Mutant ß-galactosidase protein6. (3) Two amino acids are shown below. Draw what they would like after being joined by a peptide bond.H R1 H R2H R1 H R2 | | | | | | | | H – N – C – C – OH + H – N – C – C – OH = H – N – C – C – N – C – C – OH | || | || | || | || H O H O H O H O7. (3) During mRNA splicing, a 2’-5’ bond is formed between which two nucleotides? Answer - da) G and C b) G and T c) G and U d) G and A e) U and A28. (3) In eukaryotes, the class of RNA that is translated is called __mRNA__, which is transcribed exclusivelyby RNA polymerase _____II______.9. (3) The following DNA fragment contains a gene’s translation initiation codon.Translation start __↓_3’ GCGGTGTAACTATAA 5’5’ CGCCACATTGATATT 3’  template strandThe orientation of the template strand for mRNA synthesis must be: Answer - ca) upper strand, 5’  3’ orientationb) lower strand, 3’  5’ orientationc) lower strand, 5’  3’ orientationd) upper strand, 3’  5’ orientatione) none of the above.10. (4) If the AAUAAA sequence is removed from a eukaryotic mRNA, which event will not occur?a) 5’ cap additionb) Cleavage and poly-adenylation of the mRNA Answer - bc) Splicing of intronsd) Transport to the cytoplasme) None of the above11. (3) A tRNA with the anticodon 5’ UCG 3’ would base pair with which codon(s)? Answer - ca) 5’ AGC 3’ and 5’ AGU 3’ b) 5’ AGC 3’ only c) 5’ CGA 3’ and 5’ CGG 3’d) 5’ CGA 3’ only e) 5’ CGA 3’, 5’ CGI 3’ and 5’ CGG 3’12. (3) If the following eukaryotic mRNA were properly modified and sent to the cytoplasm, what size protein (in amino acids) would it encode? ____.____.___.____.____.____.____.___.____.____.____.___.____.____.stop5’UCAGGAGGUUAUGGACCAUUGCUGGGACCUUUACAUGCUGUACCAUAGUUCAUGAUAGCCAUG3’a) 16 b) 14 c) 10 d) 13 e) 7 Answer - b13. (3) State the name of processes 1, 2 and 3 denoted below. 2 3 1) replicationDNA RNA Protein 2) transcription3) translation 114. (4) What is the function of EF-Tu during translation in prokaryotes? Answer - ca) Brings N-formylmethionine-tRNA to the ribosome P site.b) Releases EF-Ts from the ribosomec) Brings aminoacyl tRNAs to the ribosome A sited) Binds to stop codons in the ribosome A sitee) Causes the formation of a peptide bond during elongation15. (3) ß-galactosidase converts: Answer - da) lactose to two glucose molecules b) Glucose to galactose c) Galactose to lactosed) lactose to glucose and galactose e) Galactose to glucose and lactose316. (3) A partial diploid of genotype I- P+ O+ Z+ Y-/ I+ P+ O+ Z- Y+ will show: Answer - aa) Inducible production of ß-galactosidase and permease.b) Constant expression of ß-galactosidase and inducible expression of permeasec) Constant expression of ß-galactosidase and permease.d) No production of ß-galactosidase and inducible permease.e) Constant expression of ß-galactosidase and no expression of permease.17. (4) In the trp operon, high levels of tryptophan lead to base pairing between RNA segments __3 and 4___in the leader sequence. This base pairing results in the __termination__ of transcription.18. (3) Label the regulatory elements A and B in the eukaryotic gene below. +1bp a) enhancer orA B silencer b) TATA box or -2000bp -30bp promoter19. (3) A transcriptional activator binds to the sequence TAAGGTACCTTA as a dimer. Which functional domainsmust this protein contain?Must contain a DNA binding domain (it binds to DNA), a activation domain (it activates transcription) anda dimerization domain (it binds as a