MCB 250 Fall 2023 Discussion Worksheet Week 6 Oct 5 10 1 Aminoacyl tRNA synthetases have also been called amino acid activating enzymes a In what sense do these enzymes activate amino acids a Aminoacyl tRNA synthetases forming high energy aminoacyl tRNA complexes through ATP driven reactions ensuring accurate genetic translation during protein synthesis acids by activate amino b Aminoacyl tRNA synthetases must recognize several different substrates What are they Aminoacyl tRNA synthetases recognize diverse substrates specific amino acids and corresponding tRNA molecules vital for precise amino acid attachment maintaining cellular functions and genetic fidelity in protein synthesis 2 The following is the DNA sequence of a gene encoding a small protein AACGATGCCATCAGAGCCCAGGACGTGATTTAA TTGCTACGGTAGTCTCGGGTCCTGCACTAAATT C a Assume that transcription proceeds from the left to right and begins at the first base shown Also assume translation requires an initiation codon and begins at the first one encountered what is the protein sequence encoded by the above mRNA Label the N and C termini See the codon table at the end DNA template 3 TTGCTACGGTAGTCTCGGGTCCTGCACTAAATT 5 mRNA 5 AACGAUGCCAUCAGAGCCCAGGACGUGAUUUAA 3 b Suppose that a C becomes mistakenly inserted into the position indicated between A and G due to a mistake during replication What will be the sequence of the protein now mRNA 5 AACG AUG CCA UCA GAG CCC AGG ACG UGA UUUAA 3 Protein sequence N termini Met Pro Ser Glu Pro Arg Thr C termini c Suppose that an additional two G s become inserted into the mutant gene in c above at the position shown between A and G What will the sequence of the protein be now DNA template 3 TTGCTACGGTAGTCTCGGGTCCTGCACTAAATT 5 Mutated DNA 3 TTGCTACGGTACGTCTCGGGTCCTGCACTAAATT 5 Mutated mRNA 5 AACG AUG CCA UGC AGA GCC CAG GAC GUG AUU UAA 3 Mutated Protein N termini Met Pro Cys Arg Ala Gln Asp Val Ile C termini 3 Briefly explain the initiation and elongation steps during translation in E coli Initiation and elongation are two key steps in the process of translation in E coli which is the synthesis of proteins from messenger RNA mRNA molecules Here s a brief explanation of these steps 1 Initiation During initiation the small ribosomal subunit binds to the mRNA molecule at the start codon typically AUG with the help of initiation factors The initiator tRNA carrying the amino acid methionine or formylmethionine in bacteria then attaches to the start codon on the mRNA This complex is known as the initiation complex 2 Elongation Once the initiation complex is formed the process of elongation begins During elongation the ribosome moves along the mRNA molecule adding amino acids to the growing polypeptide chain In conclusion initiation involves the assembly of the ribosome and the binding of the initiator tRNA to the start codon while elongation is the step where amino acids are added to the growing polypeptide chain through a series of repeated steps 4 DNA repair mechanisms A What are the common themes for the major DNA repair mechanisms Major DNA repair mechanisms share several common themes that include the recognition of DNA damage signal activation DNA lesion processing and the restoration of the DNA sequence These processes ensure the integrity and stability of the genetic material within cells DNA repair mechanisms are vital for maintaining genomic integrity and preventing the accumulation of mutations that can lead to various diseases including cancer B What are the health consequences of inherited mutations in DNA repair pathway proteins Can you name a couple mentioned in class Are there others that you know of Inherited mutations in DNA repair pathway proteins can have various health consequences including an increased risk of developing certain types of cancers Two examples that are often mentioned in class are mutations in the BRCA1 and BRCA2 genes which are associated with an increased risk of breast and ovarian cancers Other known health consequences include a higher susceptibility to certain types of skin cancer such as xeroderma pigmentosum caused by mutations in the nucleotide excision repair pathway genes