EEMB102 – Lecture 4TodayInferring Common AncestryPhylogenies represent hypotheses of common ancestryA. Characters and Character StatesCharacter EvolutionHomologous charactersHomologous character (hair)How many possible unrooted, bifurcating (=no polytomies) trees for four OTUs ? (m.socrative.com)Homoplasy – Independent EvolutionHomoplastic character (no tail)Incorrect PhylogenyHomoplasy – Fundamental Problem for Inferring PhylogenyThe importance of congruenceCongruence (More Characters = More Confidence)Sources of CharactersPrimary Goal is to Quantify Homology versus Homoplasy for Different Phylogenetic Hypotheses How? B. Parsimony ExampleMain Steps to Inferring Phylogenies1. Choose OTU’s Today’s Example: Ape Phylogeny2. Choose Traits Example DNAHow Many Different Unrooted Trees for Four Taxa?Three Possible TreesHow Many Steps Required For Tree HG?How Many Steps Required For Tree? Calculate # steps for each siteHow Many Steps Required For Tree? Calculate # steps for each siteSlide 26Slide 27Slide 28Slide 29Slide 30Slide 31Slide 32How Many Steps Required For Tree? Several Constant SitesSlide 34Slide 35Slide 36Slide 37Slide 38How Many Steps Required For Tree?Slide 40Slide 41Slide 42Slide 43How Many Steps Required For Tree? Assess HO TreeHow Many Steps Required For Tree? 1. Find Constant SitesHow Many Steps Required For Tree? 2. Find Parsimony Uninformative SiteSlide 47How Many Steps Required For Tree? 3. Assess Remaining SitesSlide 49Slide 50Slide 51Slide 52How Many Steps Required For Tree? 4. Sum Sites for HO TreeHow Many Steps Required For Tree? Calculate Steps for HC TreeHow Many Steps Required For Tree? Find Constant SitesHow Many Steps Required For Tree? Calculate Remaining SitesSlide 57How Many Steps Required For Tree? Sum Steps Over All SitesHow Many Steps Required This Pattern? (Assuming Parsimony)Choose Best TreeSlide 61PowerPoint PresentationII. ROOTINGDifferent Ways to Represent a PhylogenyRootingOutgroup RootingSlide 67Slide 68Rooting – “Pulley Principle”Slide 70Slide 71Slide 72Slide 73Slide 74Slide 75Slide 76Slide 77Slide 78Slide 79Slide 80Slide 81Slide 82Slide 83Slide 84Slide 85Slide 86Slide 87Next TimeEEMB102 – Lecture 4Inferring PhylogeniesToday•How do we estimate phylogenetic relationships -- Parsimony example•Rooting – Pulley principleI. Inferring Common AncestryPhylogenies represent hypotheses of common ancestryA. Characters and Character States•Organisms are comprised of sets of features or character s•Species (taxa) may differ with respect to a character•Different conditions of a character are called character statesCharacter Evolution•Characters and states are heritable and are passed from ancestor to descendent•Similarities and differences in character states provide the basis for inferring phylogenyHomologou s characters•A homologous character state is inherited from a common ancestor•Hair in bats and mice is homologous•Homologous characters define phylogenetic relationshipsHomologous character (hair)LizardFrogDogHumanNo HairHairChangeor StepHow many possible unrooted, bifurcating (=no polytomies) trees for four OTUs ?(m.socrative.com)•A=2•B=3•C=4•D=5•E=infiniteHomoplasy – Independent Evolution•Homoplasy is similarity that is not homologous (not due to common ancestry)•Homoplasy is the result of independent evolution (convergence, parallelism, reversal)•Homoplasy provides misleading evidence of phylogeny (if interpreted as homology)Homoplastic character (no tail)LizardFrogDogHumanNo Adult TailTailChangeor StepIncorrect PhylogenyLizardFrogDogHumanNo Adult TailTailChangeor StepHomoplasy – Fundamental Problem for Inferring Phylogeny•If no homoplasy existed, inferring phylogeny would be unambiguous•Distinguishing the misleading evidence of homoplasy from the reliable evidende of homology is the fundamental challenge of phylogenetic inferenceThe importance of congruence•The importance for classification of trifiling characters, mainly depends on their being correlated with several other characters of more or less importance. The value indeed of an aggregate of characters is very evident ….. a classification founded on any single character, however important that may be, has always failed. -Darwin (1859)Congruence (More Characters = More Confidence)LizardFrogDogHumanNo HairHairMAMMALIAHairSingle bone in lower jawLactation,Etc.Sources of Characters•Morphological Features–Bones, Flower Parts, Limbs, etc.•Molecular Features–DNA, RNA, Proteins•Behavior•Any Heritable FeaturePrimary Goal is to Quantify Homology versus Homoplasy for Different Phylogenetic HypothesesHow?B. Parsimony ExampleMain Steps to Inferring Phylogenies1. Choose OTU’s2. Choose traits to compare in selected OTU’s3. Choose “optimality criterion” (e.g. Parsimony)4. Compare all possible trees1. Choose OTU’sToday’s Example: Ape PhylogenyHumanChimpOrangutanGorilla2. Choose TraitsExample DNAHuman TAGCTGACTCACTGATCTCCTChimp TAGCTGACTGACTGATCGCCTGorilla TACCTGACTGACTGTTCGGCGOrangutan TTCCTGACTCACTGTTCGGAGHow Many Different Unrooted Trees for Four Taxa?HumanChimpOrangutanGorillaThree Possible TreesHCHGHOHow Many Steps Required For Tree HG?Human TAGCTGACTCACTGATCTCCTChimp TAGCTGACTGACTGATCGCCTGorilla TACCTGACTGACTGTTCGGCGOrangutan TTCCTGACTCACTGTTCGGAGHow Many Steps Required For Tree?Calculate # steps for each siteHuman TAGCTGACTCACTGATCTCCTChimp TAGCTGACTGACTGATCGCCTGorilla TACCTGACTGACTGTTCGGCGOrangutan TTCCTGACTCACTGTTCGGAGSteps: 0TTTTHow Many Steps Required For Tree? Calculate # steps for each siteHuman TAGCTGACTCACTGATCTCCTChimp TAGCTGACTGACTGATCGCCTGorilla TACCTGACTGACTGTTCGGCGOrangutan TTCCTGACTCACTGTTCGGAGSteps: 0TTTTHow Many Steps Required For Tree? Calculate # steps for each siteHuman TAGCTGACTCACTGATCTCCTChimp TAGCTGACTGACTGATCGCCTGorilla TACCTGACTGACTGTTCGGCGOrangutan TTCCTGACTCACTGTTCGGAGSteps: 0AAATHow Many Steps Required For Tree? Calculate # steps for each siteHuman TAGCTGACTCACTGATCTCCTChimp TAGCTGACTGACTGATCGCCTGorilla TACCTGACTGACTGTTCGGCGOrangutan TTCCTGACTCACTGTTCGGAGSteps: 01AAATHow Many Steps Required For Tree? Calculate # steps for each siteHuman TAGCTGACTCACTGATCTCCTChimp TAGCTGACTGACTGATCGCCTGorilla TACCTGACTGACTGTTCGGCGOrangutan TTCCTGACTCACTGTTCGGAGSteps: 01GCGCHow Many Steps Required For Tree? Calculate # steps for each siteHuman TAGCTGACTCACTGATCTCCTChimp TAGCTGACTGACTGATCGCCTGorilla TACCTGACTGACTGTTCGGCGOrangutan TTCCTGACTCACTGTTCGGAGSteps: 012GCGCHow Many Steps Required For Tree?