Review for Chapter 7 Lecture 5 and 6 1 The instructions specified by the DNA will ultimately specify the sequence of proteins This process involves DNA made up of different nucleotides which gets into RNA which is then into proteins made up of different amino acids In eukaryotic cells DNA gets made into RNA in the while proteins are produced from RNA in the The segment of DNA called a is the portion that is copied into RNA this process is catalyzed by RNA 4 20 109 128 2 gene Golgi kinase nuclear pore proteasome replisome sugar phosphate transcribed exported polymerase translated cytoplasm Use the numbers in the choices below to indicate where in the schematic diagram of a eukaryotic cell those processes take place 1 2 3 4 5 3 a b c d 4 nucleus transferase transcription translation RNA splicing polyadenylation RNA capping Which of the following are required for the DNA dependent RNA polymerase reaction to produce a unique RNA transcript ATP e UTP i operator sequence CTP f DNA j terminator sequence GTP g RNA dTTP h Promoter sequence Unlike DNA which typically forms a helical structure different molecules of RNA can fold into a variety of three dimensional shapes This is largely because a RNA contains uracil and uses ribose as the sugar b RNA bases cannot form hydrogen bonds with each other c RNA nucleotides use a different chemical linkage between nucleotides compared to DNA d RNA is single stranded 5 For a cell s genetic material to be used the information is first copied from the DNA into the nucleotide sequence of RNA in a process called Various kinds of RNA are produced each with different functions molecules code for proteins molecules act as adaptors for protein synthesis molecules are integral components of the ribosome molecules regulate gene expression and molecules are important in the splicing of RNA transcripts gene regulation telomere maintenance and many other processes 6 Imagine that an RNA polymerase is transcribing a segment of DNA that contains the following sequence 5 AGTCTAGGCACTGA 3 3 TCAGATCCGTGACT 5 A If the polymerase is transcribing from this segment of DNA from left to right which strand top or bottom is the template B What will be the sequence of that RNA be sure to label the 5 and 3 ends of your RNA molecule 7 List three ways in which the process of eukaryotic transcription differs from the process of bacterial transcription 8 Name three covalent modifications that can be made to an RNA molecule in eukaryotic cells before the RNA molecule becomes a mature mRNA 9 Match the following types of RNA with the main polymerase that transcribes them 8 In eukaryotic cells general transcription factors are required for the activity of all promoters transcribed by RNA polymerase II The assembly of the general transcription factors begins with the binding of the factor to DNA causing a marked local distortion in the DNA This factor binds at the DNA sequence called the box which is typically located 25 nucleotides upstream from the transcription start site Once RNA polymerase II has been brought to the promoter DNA it must be released to begin making transcripts This release process is facilitated by the addition of phosphate groups to the tail of RNA polymerase by the factor 9 The length of a particular gene in human DNA measured from the start site for transcription to the end of the protein coding region is 10 000 nucleotides whereas the length of the mRNA produced from this gene is 4000 nucleotides What is the most likely reason for this difference 10 The genetic code specifies which amino acids are encoded by the codons on the mRNA It is because some amino acids have more than one codon codons do not specify an amino acid 11 Use the genetic code shown to identify which of the following nucleotide sequences would code for the polypeptide sequence arginine glycine aspartate a b c d 12 a b c d 5 AGA GGA GAU 3 5 ACA CCC ACU 3 5 GGG AAA UUU 3 5 CGG GGU GAC 3 Which of the following is not a key advantage of wobble in the codon anticodon reaction It allows for fewer tRNAs in the cell It allows for making more than one protein from the same coding sequence It allows for a certain amount of mutation in the mRNA without affecting the protein sequence All of these are advantages of wobble 13 The in a tRNA molecule is designed to base pair with a complementary sequence of three nucleotides the in an mRNA molecule 14 Wobble base pairing occurs between the first position in the codon and the third position in the anticodon True or false 15 In all cells a special molecule recognizing the codon AUG and carrying the amino acid provides the amino acid that begins a protein chain 16 Which of the following pairs of codons might you expect to be read by the same tRNA as a result of wobble a b c d CUU and UUU GAU and GAA CAC and CAU AAU and AGU 17 The piece of RNA below includes the region that codes for the binding site for the initiator tRNA needed in translation 5 GUUUCCCGUAUACAUGCGUGCCGGGGGC 3 Which amino acid will be on the tRNA that is the first to bind to the A site of the ribosome a methionine b arginine c cysteine d valine 18 A mutation in the tRNA for the amino acid lysine results in the anticodon sequence 5 UAU 3 instead of 5 UUU 3 Which of the following aberrations in protein synthesis might this tRNA cause a b c d read through of stop codons substitution of lysine for isoleucine substitution of lysine for tyrosine substitution of lysine for phenylalanine 19 Once an mRNA is produced its message can be decoded on ribosomes The ribosome is composed of two subunits the subunit which catalyzes the formation of the peptide bonds that link the amino acids together into a polypeptide chain and the subunit which matches the tRNAs to the codons of the mRNA During the chain elongation process of translating an mRNA into protein the growing polypeptide chain attached to a tRNA is bound to the site of the ribosome An incoming aminoacyl tRNA carrying the next amino acid in the chain will bind to the site by forming base pairs with the exposed codon in the mRNA The enzyme catalyzes the formation of a new peptide bond between the growing polypeptide chain and the newly arriving amino acid The end of a proteincoding message is signaled by the presence of a stop codon which binds the called release factor Eventually most proteins will be degraded by a large complex of proteolytic enzymes called the A central DNA E large medium P peptidyl transferase polymerase proteasome protein RNA