GCD 3022 1st Edition Lecture 19 Outline of Last Lecture I Protein synthesis review a Structural genes b Translation II Codons a Codon traits b Special codons III Polypeptide chain a Directionality b Amino groups i Two ends of an amino group ii R groups c Peptide bonds IV Structure of proteins a Levels of structure i Primary ii Secondary iii Tertiary iv Quaternary These notes represent a detailed interpretation of the professor s lecture GradeBuddy is best used as a supplement to your own notes not as a substitute b Function of proteins i Relationship between function and structure ii Enzymes V Structure and function of tRNA a Adaptor hypothesis b RNA has two functions c Common structural features i Folding of tRNAs ii Charging of tRNAs d Wobble rule VI Functional sites of ribosomes a Location of mRNA during translation b Ribosome sites VII Stages of translation a Initiation i Initiation complex ii Start codon iii Binding of mRNA to 30S subunit iv Eukaryote initiation summary b Elongation i Addition of amino acids c Termination i Stop codon ii Release factors VIII Bacterial translation a Bacterial cell structure b Translation patterns in bacteria Outline of Current Lecture I Transcription a Rho independent and rho dependent b Sigma factor i Mutation ii Transcription initiation and role of sigma factor c Transcription region d Coding and template strands II Translation a Gene mapping b Splicing i Mutation ii Introns and exons iii Coding information in eukaryotes c Translated RNAs i Type of translated RNA ii tRNA anticodon d Mistakes in translation i Anti codon mutation ii Start and stop codons e Termination of translation i Site of termination ii Number of codons translated f Prokaryotic vs Eukaryotic initiation g A P and E sites III Consensus sequence IV Degenerate genetic code Current Lecture I Transcription a Rho independent and rho dependent both types of transcription termination require the formation of the stem loop secondary structure in RNA b Sigma factor i Mutation if there is a strain of bacteria that produces a non functional sigma factor then that bacteria will be unable to identify and tightly bind promoter elements ii Transcription initiation and role of sigma factor sigma factor associates with the RNA polymerase core enzyme to create the holoenzyme Sigma factor is responsible for identifying good 35 to 10 sequences to which it binds tightly to form a closed complex A short RNA is made and an open complex is formed Then the sigma factor is released from the initiation complex and elongation begins c Transcription region the promoter and terminator define the region of transcription in a protein encoding gene d Coding and template strands if given two sample sequences of DNA and one sequence of RNA and asked to identify which strand is coding and which is the template remember that RNA polymerase moves along the template strand in the 3 to 5 direction and that the coding strand s sequence matches that of the RNA strand in the 5 to 3 direction II Translation a Gene mapping a specific disease causing mutation is mapped and found to follow the Mendelian inheritance pattern mutation is recessive But there is no evidence of the mutation when the exons are sequenced The two possible reasons for not being able to see the mutation are i The mutation is a wobble base ii The mutation is a transcriptional control sequence b Splicing i Mutation if there is a mutation such that the 5 splice site is eliminated from intron 2 of a string of pre mRNA with 4 exons then both intron 2 will remain in the final mRNA product exon 1 exon 2 intron 2 exon 3exon 4 ii Introns and exons splicing removes introns and joins exons to form mRNA iii Coding information in eukaryotes the regions of DNA that contains the coding information for a protein in eukaryotes are called exons c Translated RNAs i Type of translated RNA the type of RNA that is translated is mRNA ii tRNA anticodon a tRNA anticodon is both antiparallel and complimentary to the mRNA codon Therefore a tRNA with the sequence 5 GAA 3 will match with its complementary and antiparallel codon 5 UUC 3 which codes for the amino acid phenylalanine d Mistakes in translation i Anti codon mutation the least likely event that would lead to the wrong amino acid in a protein would be the change in the wobble base of the codon ii Start and stop codons if a mutation changes a start codon to a stop codon then the cell will be unable to translate the mRNA into a functional protein e Termination of translation i Site of termination translation is terminated when a stop codon is presented at the A site of the ribosome ii Number of codons translated an mRNA with the sequence 5 CCAGAUGGUUACAAAAUAACAUCAA 3 will begin translation with the AUG start codon and end with UAA UAG or UAC stop codon That means that there will be 4 amino acids in this polypeptide and the last amino acid in this chain would be lysine AAA f Prokaryotic vs Eukaryotic initiation In eukaryotes the ribosome binds at the 5 end of the mRNA and then scans in the 3 direction in search of an AUG start codon If it finds one that reasonably obeys Kozak s rules it will begin translation at that site In prokaryotes sequences in the 16S ribosomal RNA bind to a Shine Dalgarno sequences which positions the ribosome to initiate translation at an AUG codon a few nucleotides downstream from the SD sequence g A P and E sites i Initiation once the ribosome is positioned on a good AUG codon an initiator tRNA is brought into the P site to begin translation ii Elongation another tRNA binds to the A site next to the P site A peptide bond is formed between the first amino acid and the second The initiator tRNA then leaves through the E site when the ribosome translocates to the next codon This process continues with new tRNAs binding to the A site iii Termination a stop codon is reached on the mRNA strand The presence of the stop codon in the A site causes the ribosome to dissociate from the mRNA and the polypeptide to break off from the tRNA III Consensus sequence a consensus sequence is the collective sequence of multiple strands of DNA based on the most common bases IV Degenerate genetic code this means that more than one codon can code for a single amino acid