Lectures 30 and 31 Identifying human disease genes The one gene you are interested in could be any of the 20 000 genes in the human genome If you are interested in studying a human disease how do you find out which gene when mutated causes that disease Which one is it 7 03 Fall 2006 7 03 Fall 2006 Examples of disease we ve already discussed DISEASE GENE THAT IS MUTATED NORMALLY ENCODES Why would you want to map one of these genes If you find the gene you know the protein that is affected and often how it is affected study normal human physiology Sickle Cell Anemia create diagnostic tests Hemophilia design treatments Cystic Fibrosis e g If the normal protein is gone can you provide it If the normal protein is overactive can you inhibit it with a drug 7 03 Fall 2006 7 03 Fall 2006 1 How do we identify the right gene Each of the 20 000 genes in the human genome has a unique map position in the genome Each gene is found at the same position in all members of our species You can find that position by genetic mapping How have we done genetic mapping previously in 7 03 In flies In yeast In bacteria In all of these ways we map our one unknown locus with respect to many known loci 7 03 Fall 2006 7 03 Fall 2006 Where is the unknown gene trpX in which you are interested Why did we do mapping differently in flies yeast and bacteria malA thrC sucB araD galL alaK ileE nytJ valI proH lacG What Distance is Being Measured malA to trpX sucB to trpX thrC to trpX araD to trpX ileE to trpX leuF to trpX lacG to trpX proH to trpX valI to trpX nytJ to trpX alaK to trpX 7 03 Fall 2006 galL to trpX leuF Cotransduction Frequency 0 0 0 0 10 90 20 0 0 0 0 0 Flies Yeast Bacteria Humans have a life cycle most similar to that of flies out of these three 7 03 Fall 2006 2 How we map in flies does have some similarity to how we map in humans Drosophila has 4 chromosomes X 2 3 and 4 We ask Is our trait on the X chromosome If not is our trait on chromosome 2 If not is our trait on chromosome 3 If not is our trait on chromosome 4 and then narrow our search down to a chromosomal region 7 03 Fall 2006 Why do we do mapping differently in flies and humans 1 We cannot do controlled human crosses 2 We do not have true breeding strains of humans 3 Humans do not have large numbers of offspring 4 There are not a lot of known single gene traits in humans that we can map in respect to like in flies wing veins eye color bristle length etc 7 03 Fall 2006 How do we get around these things 1 We cannot do controlled human crosses What do we do given that there aren t a lot of available traits We don t map with respect to known traits 2 We do not have true breeding strains of humans We use DNA loci like SSRs that 3 Humans do not have large numbers of offspring 4 There are not a lot of known single gene traits in humans that we can map in respect to 7 03 Fall 2006 7 03 Fall 2006 3 What are these loci such as SSRs My DNA at an SSR for example Regions of repeated junk DNA Remember most of our DNA is non coding DNA ATCGATCGATCGATCGATCGATCGATCGATCG 8 repeats from mom ATCGATCGATCGATCGATCGATCG 6 repeats from dad 7 03 Fall 2006 How do we test for which SSR alleles someone has 7 03 Fall 2006 What might the genotyping for 3 people look like Person 1 Isolate the DNA from blood or cheek cells 1 2 3 2 Do PCR using primers that flank the repeated region More repeats bigger piece of DNA A allele 3 Run out the products on a gel using electrophoresis Fewer repeats smaller piece of DNA B allele 7 03 Fall 2006 7 03 Fall 2006 4 Are these my parents Can they be my parents Mom 1 Me Dad 2 3 A allele What are SSRs used for Paternity Testing Forensics B allele Tracing human history Mapping 7 03 Fall 2006 How do we map in humans 7 03 Fall 2006 How do we map in humans 1 Collect pedigrees in which the disease is present and take blood samples of people 1 Collect pedigrees in which the disease is present and take blood samples of people 2 Do PCR and gel electrophoresis for 100s of SSRs spread throughout the genome 2 Do PCR and gel electrophoresis for 100s of SSRs spread throughout the genome 3 Do statistical analysis to determine which one SSR is the most likely to be linked to the trait locus given the pedigree data we have 3 Do statistical analysis to determine which one SSR is the most likely to be linked to the trait locus given the pedigree data we have 4 Narrow in on the genes present in the genome near to that SSR and find the right one out of these candidates 4 Narrow in on the genes present in the genome near to that SSR and find the right one out of these candidates 7 03 Fall 2006 7 03 Fall 2006 5 The statistical analysis used is called LOD score analysis LOD log of the odds LOD score The higher the LOD score the more likely it is that you saw the pedigree data because the trait locus and the SSR were LINKED than that you saw the pedigree data because the trait locus and the SSR were NOT LINKED Odds of linked the chance that you saw the pedigree data because the trait locus and the SSR were linked Odds of NOT linked the chance that you saw the pedigree data because the trait locus and the SSR were NOT linked 7 03 Fall 2006 7 03 Fall 2006 Steps of LOD score analysis What does a LOD score of 3 mean What does a LOD score of 2 mean An example Huntington s disease a neurodegenerative disorder Inheritance Symptoms Onset What should you do next if you do LOD score analysis and you get a LOD score that is in between 2 and 3 7 03 Fall 2006 Incidence 7 03 Fall 2006 6 Steps of LOD score analysis 1 Find a pedigree with a set of parents whose genotypes you know or can infer at an SSR and at the trait locus e g the HD gene and SSR518 Steps of LOD score analysis 2 Figure out which parent dad mom or both is the relevant parent 7 03 Fall 2006 7 03 Fall 2006 Steps of LOD score analysis Steps of LOD score analysis 3 Determine which alleles the relevant parent gave to each of the children at the SSR and at the trait locus 7 03 Fall 2006 4 Determine …
View Full Document
Unlocking...