17.03 - Fall 2006Lectures 30 and 31“Identifying human disease genes”If you are interested in studying a human disease,how do you find out which gene, when mutated,causes that disease?7.03 - Fall 2006The one gene you are interested in could be anyof the 20,000 genes in the human genome.Which one is it?7.03 - Fall 2006Examples of disease we’ve already discussedDISEASE GENE THAT IS MUTATED NORMALLY ENCODES:Sickle Cell AnemiaHemophiliaCystic Fibrosis7.03 - Fall 2006Why would you want to map one of these genes?If you find the gene, you know the protein that is affected and (often) how it is affected.-- study normal human physiology-- create diagnostic tests-- design treatments (e.g. If the normal protein is gone, can you provide it? If the normal protein is over- active, can you inhibit it with a drug?)27.03 - Fall 2006How do we identify the right gene?Each of the 20,000 genes in the human genomehas a unique map position in the genome.Each gene is found at the same position in allmembers of our species.You can find that position by genetic mapping.7.03 - Fall 2006How have we done genetic mappingpreviously in 7.03?In flies?In yeast?In bacteria?In all of these ways, we map our one unknownlocus with respect to many known loci.7.03 - Fall 2006Where is the unknown gene “trpX” in which youare interested?What Distance is Being Measured Cotransduction FrequencymalA to trpX 0%sucB to trpX 0%thrC to trpX 0%araD to trpX 0%ileE to trpX 10% leuF to trpX 90%lacG to trpX 20%proH to trpX 0%valI to trpX 0% nytJ to trpX 0%alaK to trpX 0%galL to trpX 0%malAaraDsucBileEleuFlacGproHvalIalaKgalLthrCnytJ7.03 - Fall 2006Why did we do mapping differently in flies,yeast, and bacteria?Flies:Yeast:Bacteria:Humans have a life cycle most similar to that offlies out of these three.37.03 - Fall 2006How we map in flies does have some similarity tohow we map in humansDrosophila has 4 chromosomes: X, 2, 3, and 4.We ask:Is our trait on the X chromosome?If not, is our trait on chromosome 2?If not, is our trait on chromosome 3?If not, is our trait on chromosome 4?… and then narrow our search down to a chromosomal region7.03 - Fall 2006Why do we do mapping differently in flies andhumans?1. We cannot do controlled human crosses.2. We do not have true-breeding strains ofhumans.3. Humans do not have large numbers ofoffspring.4. There are not a lot of known single gene traitsin humans that we can map in respect to. (like inflies: wing veins, eye color, bristle length, etc.)7.03 - Fall 2006How do we get around these things?1. We cannot do controlled human crosses.2. We do not have true-breeding strains ofhumans.3. Humans do not have large numbers ofoffspring.4. There are not a lot of known single gene traitsin humans that we can map in respect to.7.03 - Fall 2006What do we do given that there aren’t a lot ofavailable traits?We don’t map with respect to known traits.We use DNA loci (like SSRs) that:------47.03 - Fall 2006What are these loci, such as SSRs?Regions of repeated “junk” DNARemember, most of our DNA is non-codingDNA!*7.03 - Fall 2006My DNA at an SSR, for exampleATCGATCGATCGATCGA TCG ATCGATCGATCGATCGATCGATCGATCGA TCG ATCG8 repeatsfrom mom6 repeatsfrom dad7.03 - Fall 2006How do we test for which SSR alleles someonehas?1. Isolate the DNA from blood or cheek cells2. Do PCR using primers that flank the repeatedregion3. Run out the products on a gel usingelectrophoresis7.03 - Fall 2006What might the genotyping for 3 people look like? 1 2 3More repeats= bigger piece of DNAFewer repeats= smaller piece of DNA“A” allele“B” allelePerson #57.03 - Fall 2006Are these my parents? Can they be my parents? 1 2 3“A” allele“B” allele Mom Me Dad7.03 - Fall 2006What are SSRs used for?Paternity TestingForensicsTracing human historyMapping!7.03 - Fall 2006How do we map in humans?1. Collect pedigrees in which the disease is present, andtake blood samples of people2. Do PCR and gel electrophoresis for 100s of SSRsspread throughout the genome3. Do statistical analysis to determine which one SSR isthe most likely to be linked to the trait locus, given thepedigree data we have.4. Narrow in on the genes present in the genome near tothat SSR, and find the right one out of thesecandidates7.03 - Fall 2006How do we map in humans?1. Collect pedigrees in which the disease is present, andtake blood samples of people2. Do PCR and gel electrophoresis for 100s of SSRsspread throughout the genome3. Do statistical analysis to determine which one SSR isthe most likely to be linked to the trait locus, given thepedigree data we have.4. Narrow in on the genes present in the genome near tothat SSR, and find the right one out of thesecandidates67.03 - Fall 2006The statistical analysis used is called“LOD score analysis”The higher the “LOD score,” the more likely it isthat you saw the pedigree data because the trait locus andthe SSR were LINKEDthanthat you saw the pedigree data because the trait locus andthe SSR were NOT LINKED7.03 - Fall 2006LOD = “log of the odds”LOD score =Odds of linked = the chance that you saw the pedigreedata because the trait locus and the SSR were linkedOdds of NOT linked = the chance that you saw thepedigree data because the trait locus and the SSR wereNOT linked7.03 - Fall 2006What does a LOD score of +3 mean?What does a LOD score of –2 mean?What should you do next if you do LOD scoreanalysis and you get a LOD score that is inbetween –2 and +3?7.03 - Fall 2006Steps of LOD score analysisAn example:Huntington’s disease,a neurodegenerative disorderInheritance:Symptoms:Onset:Incidence:77.03 - Fall 2006Steps of LOD score analysis1. Find a pedigree with a set of parents whose genotypesyou know (or can infer) at an SSR and at the trait locus.e.g. the HD gene and SSR518:7.03 - Fall 2006Steps of LOD score analysis2. Figure out which parent (dad, mom, or both) isthe relevant parent7.03 - Fall 2006Steps of LOD score analysis3. Determine which alleles the relevant parent gave toeach of the children at the SSR and at the trait locus7.03 - Fall 2006Steps of LOD score analysis4. Determine the “phase” of the relevant parent87.03 - Fall 2006Steps of LOD score analysis5. Determine how many kids are recombinantsand how many are parentals7.03 -
View Full Document
Unlocking...