Name 7 03 Genetics Fall 2004 Massachusetts Institute of Technology Professor Chris Kaiser Professor Gerry Fink Professor Leona Samson 1 Name 2 Name 1 Drawn below is part of a wild type gene The DNA sequence shown encodes the last amino acids of a protein that is normally 380 amino acids long The bracketed codon indicates the correct reading frame of this gene The lower strand of the gene is used as the template during the transcription of mRNA from this gene GCTAAGTATTGCTCAAGATTAGGATGATAAATAACTGG 3 CGATTCATAACGAGTTCTAATCCTACTATTTATTGACC 5 a 6 pts In the copy of the sequence drawn below circle one base pair that you could change to make a mutant form of the gene that produces a protein that is now 381 amino acids long Indicate the identity of one new base pair that could take its place GCTAAGTATTGCTCAAGATTAGGATGATAAATAACTGG 3 CGATTCATAACGAGTTCTAATCCTACTATTTATTGACC 5 b 6 pts In the copy of the sequence drawn below draw a slash between two base pairs where you could add one extra base pair in order to make a single mutant form of the gene that produces a protein that is 373 amino acids long GCTAAGTATTGCTCAAGATTAGGATGATAAATAACTGG 3 CGATTCATAACGAGTTCTAATCCTACTATTTATTGACC 5 c 9 pts Multiple mutant suppressor tRNAs could suppress the early termination defect in part b by allowing a longer protein to be produced from that mutant form of the gene Make a list of all of the tRNA genes that could produce such mutant suppressor tRNAs if each tRNA gene contained a single base substitution Use the notation alatRNA 3 Name 2 You are studying the regulation of a bacterial gene called nytT which is expressed only when the bacterial strain is grown in the dark You isolate two mutations nytA1 and nytB1 which affect the regulation of nytT Genotype Strain 1 nytA Strain 5 no no nytT no no nytT F nytA1 yes no nytT F nytB1 yes no nytA nytB1 nytA nytB nytA nytT nytT wild type nytA1 Strain 3 Is nytT expressed in the light no nytB Strain 2 Strain 4 Is nytT expressed in the dark yes nytB nytB You grow P1 phage on an otherwise wild type strain that contains a transposon insertion carrying a gene that confers tetracycline resistance The transposon insertion in this strain is linked to the nytT locus with a cotransduction frequency of 85 and this insertion does not alter normal nytT regulation You use the resulting lysate to infect a r nytA1 strain and select for tetracycline resistance None of the 30 Tet cotransductants you examine express the nytT gene under any conditions You obtain the same results when you use the same P1 lysate to infect a nytB1 recipient strain a 5 pts Can you conclude if nytA1 is constitutive or uninducible If so state whether nytA1 is constitutive or uninducible and state what was the most important piece of information for example which strain in the table you used to reach your conclusion b 5 pts Can you conclude if nytA1 is dominant or recessive If so state whether nytA1 is dominant or recessive and state what was the most important piece of information for example which strain in the table you used to reach your conclusion 4 Name c 8 pts Can you conclude if nytA1 acts in cis or in trans with respect to nytT If so state whether nytA1 acts in cis or in trans and state what was the most important piece of information for example which strain in the table you used to reach your conclusion d 10 pts Diagram all possible models for regulatory pathways for nytT that can explain the behavior of the nytA1 and nytB1 mutations Please diagram only linear pathways in which each gene is controlled by no more than one regulator Please do not include any steps that invoke unknown players For each model include only the following wild type nytA nytB and nytT and bright light 5 Name 3 After you perform the experiments from Question 2 you decide to continue studying the regulation of the bacterial gene nytT which is expressed only when the bacterial strain is grown in the dark You decide to map the two mutations nytA1 and nytB1 which you isolated in Question 2 Please refer to the table in the introduction to Question 2 for information about how these mutations affect the regulation of nytT You find that the nytA and nytB loci are linked using P1 cotransduction experiments You isolate a transposon insertion that carries a gene encoding kanamycin resistance This transposon insertion is near to but not between the nytA and nytB loci a 6 pts You grow P1 phage on an otherwise wild type strain that contains the transposon insertion carrying kanamycin resistance You use the resulting lysate to infect a nytB1 strain and select for kanamycin resistance Drawn below are the E coli chromosome and the DNA transduced by P1 during this cotransduction experiment Please note that these drawings are not to scale Redraw the DNA transduced by P1 so that it lines up with the homologous region of the E coli chromosome Then draw in r the recombination events necessary to achieve the cotransduction of Tn Kan and the nytB locus Tn Kanr sucA malA alaA trpA thrA araA galA alaA ileA nytB1 valA trpA lacA leuA 6 Name r b 5 pts In the transduction experiment described in part a out of a total of 50 Kan cotransductants 15 can express the nytT gene in the dark and 35 cannot Express the distance between the transposon and the nytB locus as a cotransduction frequency To map the nytA and nytB loci you set up two reciprocal crosses In the first cross you grow P1 phage on a Kanr strain that contains the transposon insertion and the nytA1 mutation and use the resulting phage lysate to infect a nytB1 strain You select for kanamycin resistance Kanr and among 100 Kanr transductants you find that only 13 are able to express nytT All 13 show normal nytT regulation In the second cross you grow P1 phage on a Kanr strain that contains the transposon insertion and the nytB1 mutation and use the resulting phage lysate to infect a nytA1 strain You select for kanamycin resistance Kanr and among 100 Kanr transductants you find that only 3 are able to express nytT All 3 show normal nytT regulation c 6 pts Draw a genetic map showing the correct relative positions of the transposon insertion Tn Kanr and the nytA and nytB loci in this box d 6 pts Based on the gene order that you drew in part c state the chromosomal genotype of a transductant that must have resulted from a quadruple crossover event between the transduced DNA and the bacterial chromosome of the recipient in the first cross Be sure to indicate the chromosomal genotype at both the nytA and
View Full Document
Unlocking...