7 03 Problem Set 3 Due before 5 PM on Wednesday October 18 Hand in answers in recitation section or in the box outside of 68 120 1 The following DNA sequence fragment comes from the middle of a bacterial gene To start the analysis of this coding sequence you will first need to find the open reading frame note that you do not know the orientation of the gene 5 CTCGGCTAATATCGATCGCTAGTGTCATAGCTCTCGGGTAATGACGATCACGA 3 a Within this segment of DNA note all of the possible nonsense mutations that can be produced by a single base change by a mutagen that causes only transition mutations G C to A T or A T to G C b Within this segment of DNA note all of the possible single base change nonsense mutations that can be produced by a single base transversion mutation c Consider the gene for tRNAtrp Write out the double stranded DNA segment of this gene that codes for the anticodon of tRNAtrp be sure to label 5 and 3 ends Write out all of the possible mutations that can convert tRNAtrp to a nonsense suppressing tRNA For each mutation indicate whether it is a transition or transversion and which kind of nonsense mutation will be suppressed 2 The diagram below shows the F factor and a portion of the E coli chromosome that has three different insertion sequences IS of the same type as is carried on F Assume that you have available a variety of strains with mutations in the genetic markers A B C D a Describe with as much detail as you can how you would use this F strain to isolate an F factor that carries the B marker For your answer diagram any relevant intermediate strains as well as the final F factor For your answer please show all of the markers as well as the position and orientation of each IS sequence and the origin of transfer ori T 3 Wild type E coli can utilize the sugar galactose and is therefore phenotypically Gal You have isolated a mutant that you call gal1 which cannot grow on galactose Gal a You have a wild type Gal strain carrying a Tn5 insertion You grow P1 phage on this strain and use the resulting phage lysate to infect the gal1 strain selecting for kanamycin resistance Kanr Among 100 Kanr transductants you find that 75 are Gal and 25 are Gal What does this result tell you about the relationship between the gal1 mutation and the Tn5 insertion b You grew P1 phage on one of the Gal Kanr transductants isolated in part a and then used these phage to transduce a wild type strain What fraction of the Kanr transductants would be Gal c You isolate a second Gal mutation which you designate gal2 Using the same P1 lysate as in part a you infect the gal2 strain selecting for Kanr transductants In this case none of the 100 Kanr transductants are Gal What does this result tell you about the relationship between the gal1 and gal2 mutations c Next you isolate a third Gal strain called gal3 Preliminary P1 transduction experiments indicate that gal3 is linked to the Tn5 insertion described in part a To map gal3 relative to gal1 you set up two reciprocal crosses In the first cross you grow P1 on a strain that carries the Tn5 insertion and the gal1 mutation You then use this lysate to infect a gal3 mutant and select for Kanr From 100 Kanr transductants examined 85 are Gal and 15 are Gal In the second cross you grow P1 on a strain that carries the Tn5 insertion and the gal3 mutation You then use this lysate to infect a gal1 mutant and select for Kanr From 100 Kanr transductants examined 98 are Gal and 2 are Gal Draw a genetic map showing the relative positions of the Tn5 insertion and the gal1 and gal3 mutations Express any measured distances as co transduction frequencies d Explain why it is necessary to carry out two reciprocal three factor crosses in part c in order to determine the relative positions of the gal1 and gal3 mutations 4 An F HisA E coli strain can be converted to His by a variety of different genetic manipulations including transduction with a P1 phage lysate grown on a HisA strain mating to an Hfr strain that carries HisA on the chromosome or mating to a strain with HisA on an F factor You are given a variety of HisA strains with unknown genetic properties You subject each strain to a variety of genetic tests to diagnose how it may have been altered Based on the outcome of these tests deduce which genetic capabilities have been altered then propose a specific type of mutation or genetic alteration that might give rise to these properties This question is intended to stretch your thinking about bacterial genetics somewhat beyond what has been explicitly covered in lecture Possibilities you should consider include acquisition of various kinds of mutations or extra chromosomal elements For some strains more than one mechanism is possible a Strain 1 can be converted to His by conjugation with either a HisA Hfr or an F HisA strain but cannot be converted to His by P1 transduction b Strain 2 can be converted to His by conjugation with an F HisA strain but cannot be converted to His by P1 transduction or by conjugation with a HisA Hfr c Strain 3 can be converted to His by P1 transduction but cannot be converted to His by conjugation with either a HisA Hfr or an F HisA strain d Strain 4 can be converted to His by P1 transduction or by conjugation with a HisA Hfr but cannot be converted to His by congugation with an F HisA strain e Strain 5 cannot be converted to His by P1 transduction or by conjugation with either a HisA Hfr or an F HisA strain
View Full Document
Unlocking...