CCJ4601 EXAM 2 STUDY GUIDE HUMAN BEHAVIOR GENES There are approximately 25 000 genes in the human body Genes are stretches of DNA that work together to perform specialized functions To better understand we need to discuss DNA DNA DNA is a chemical code that allows us to form develop and live human functioning DNA is stored in the nucleus of every cell except for the red blood cells Information encoded into DNA determines virtually every observable and unobservable characteristic People vary because of DNA varies Every person has their own unique sequence of DNA except MZ twins Each person s arrangement of genes is referred to as a genotype THE STRUCTURE OF DNA FORM OF DOUBLE HELIX Two fibers twisted around each other to form double helix Each fiber is referred to as a polynucleotide Along the backbone of each polynucleotide is a sequence of nucleotides also called bases THERE ARE FOUR DIFFERENT TYPES OF BASES Adenine A Thymine T Cytosine C Guanine G These four bases make up the genetic alphabet HOW ARE THE TWO POLYNUCLEOTIDES HELD TOGETHER Through bonds between bases Specifically A pairs with T and G pairs with C These bonds hold the two strands of DNA together The ordering of base pairs is very important Very small divergences can alter drastically what we are studying Humans and chimpanzees share over 96 percent of their DNA Humans share 99 percent of their DNA and 0 1 percent is responsible for making changes among the human population At various segments along the DNA contiguous base pairs work together These base pairs working together are called genes In reality genes are made up of 1000 or more base pairs WHAT DO GENES DO They code for the production of proteins Proteins are essential to life Structural proteins hair fingernails etc Functional proteins coordinate actions and activities of the body Genes are configured on thread like structures called chromosomes The human body contains 23 pairs of chromosomes one pair inherited maternally and the other paternally Females have two X chromosomes and Males have an XY chromosome Every person has two copies of most genes one from mom and one from dad These two copies make up the entire gene Every copy is referred to as an allele 2 allele 1 gene For most genes only one allele exists in the population But for a small fraction of genes there are at least 2 alleles that are in existence These genes are called polymorphisms Polymorphisms are the utmost interest because it provides examples of heights INTRODUCTION TO GENETICS HOW DO GENES VARY 1 Single nucleotide polymorphisms one single nucleotide is different in the alleles ACGAGGACCAGTTA ACGAGCACCAGTTA o 1 000 different diseases are carried in that difference of one letter in the gene variance 2 Short tandem repeats STRs TAGGAATTATTATTATTATTA 5 Repeats TAGGAATTATTATTA 3 Repeats o Name of allele is the number of times the letters are repeated 3 Variable number of tandem repeats VNTRs o The more nucleotides repeated hundreds of times o Single Gene Single Phenotype o Apply to health related outcomes o Many criminologists fear this because they think there will be a single crime TERMS Genotype each person unique sequence of DNA Phenotype measureable human characteristics EX personality traits Criminologists rarely don t use or know about this term HOW CAN GENES AFFECT PHENOTYPES One gene one disorder OGOD gene found Polygenic o Many Genes Single Phenotype o Each gene have a very small effect on outcomes Pleiotrophic o One Gene Multiple Phenotypes GENES AND THE ENVIRONMENT personality traits Not nature vs nurture but nature and nurture Referred to as a gene environment interplay Two main types of gene environment interplays o Gene X Environment interactions G x E o Gene X Environment correlation rGE GENE X ENVIRONMENT INTERACTIONS G x E Genes and the environment often combine to create different behaviors and different Genetics effects are only visible in certain environments 2 people in the same environment may interpret it and react to it differently because of their unique genotypes G x E can explain why rehabitation efforts work for some people G x E can explain why the environment does not have the same effect on all people Remember Caspi article found that certain genes only had certain effect in certain environments Classic example of G x E a growing body of empirical evidence has revealed the importance of G x E in the etiology of crime and delinquency GENE X ENVIRONMENT CORRELATIONS rGE We often see that an environment is related to a person s behavior Ex an intelligent child is often surrounded with books and other cognitive forms IQ is one of the most heritable traits smart people have smart children rGE refer to the close association between genes o passive rGE o active rGE o evocative rGE children receive two elements from parents gene and environment passively receive both from their parents the environment is largely a reflection of their parents genetic propensities ex IQ individuals play an active role in seeking out environments that are compatible with their genetic tendencies engage in niche picking Ex thrill seeking and skydiving delinquent peers mating people elicit certain responses from their environment based in large part on their genotype two people will elicit two responses from the same environment Ex bad temper attractiveness PASSIVE rGE ACTIVE rGE EVOCATIVE rGE WHICH GENES MAY RELATE TO ANTI SOCIAL BEHAVIOR Genes responsible for the production transportation and breaking down of neurotransmitters are the most promising WHAT ARE NEUROTRANSMITTERS Chemical messages that allow for communication between neurons Billions of neurons in the human body Thousands of connections for each neuron Space between neurons synaptic cleft or synapse To bridge the space neurotransmitters are released from one neuron where they cross the synaptic cleft and relay the message to the adjacent neuron Presynaptic neuron Postsynaptic neuron After receiving the message they need to be removed from the synapse Two ways this happens o Reuptake transporter protein is developed and capture these neurotransmitters from synapse and return them to the presynaptic neuron to be used again o Enzymes MAOA destroy these neurotransmitters and disable their functioning If either of these two processes malfunctions then changes in the emotion temperament and behavior can occur In addition certain medications get their pharmacological properties by altering levels of neurotransmitters o SSRI