GENES Introduction to Genetics o There are approximately 25 000 genes in the human body o Genes are stretches of DNA that work together to perform specialized functions o To better understand gene we need to discuss DNA o DNA is a chemical code that allows us to form develop and live o DNA is stored in the nucleus of every cell except for red blood cells o Information coded to DNA determines virtually every observable and many unobservable characteristics second half debated by criminologists o People vary because their DNA varies o Every person has their own sequence of DNA aside from MZ twins o Each person s arrangement of genes is referred to as a genotype o The structure of DNA 1 Two fibers twisted around each other to for a double helix 2 Each fiber is referred to as polynucleotide poly means a lot 3 Along the backbone of each is a sequence of nucleotides o There are four types of bases 1 Adenine 2 Thymine 3 Cytosine 4 Guanine o How are the two polynucleotides held together Through bonds between the bases Specifically A pairs with T and G pairs with C These bonds hold the two strands of DNA together o The ordering of pairs base is very important o Very small divergences can alter drastically what we are studying o Humans and Chimps share over 96 of their DNA We often fail to realize how similar we are o Humans share about 99 9 of their DNA o 01 of DNA is responsible for many of the changes among the human population You and I share between 90 99 o At various segments along DNA contiguous base pairs work together o These base pairs working together are called genes o In reality genes are made up of 1 000 or more base pairs o What do genes do 1 They code for production of proteins 2 Proteins are essential to life Structural proteins hair tendons fingernails Functional proteins coordinate actions and all activities of the body we will focus on functional proteins because partially responsible for brain activity o Genes are configured on threadlike structures called chromosomes o The human body contains 23 pairs of chromosomes one pair is inherited maternally and one pair is inherited paternally o Females have two X chromosomes and males have an X and Y chromosomes o Every person has 2 copies of most genes one from mom and one from dad o The two copies make up the entire gene o Each copy is referred to as an allele 2 allele 1 gene o For most genes only one allele exists in the population o But for a small fraction of genes there are at least two alleles that are in existence o These genes are referred to as polymorphisms Polymorphisms are genes that can vary Why Example with height o How do genes vary 1 Single nucleotides polymorphisms ACGAGGACCAGTTA ACGAGCACCAGTTA 2 Short tandem repeats TAGGAATTATTATTATTATTA TAGGAATTATTATTATTATTA 3 Variable of tandem repeats VNTRs Same as STRs except more nucleotides are repeated hundreds Different polymorphisms can affect the functioning of the human body Genotype How can genes affect phenotypes o One gene one disorder o Polygenic and pleiotropic effects OGOD o Single gene single phenotype o Not genetic determinism Polygenic Effects Many Genes Single phenotype o This does not mean if you have these alleles you will be a criminal o Not deterministic but probabilistic o Gene will only count for a small effects percentage not deterministic Pleiotropic effect One gene Multiple phenotypes o Research suggest that crime is the effect of plietropic effects o Neglecting role of environment for all 3 Genes and the environment o Genes and the environment often combine to create different behaviors and different personality traits o Not nature vs nurture but nature and nurture o Referred to as gene environment interplay o Epigenetics is a type of o Two are types of gene environment interplay 1 Gene X environment interactions GxE 2 Gene X Environment Correlations rGE Gene X Environment interactions o Genetic effects are only visible in certain environments o Two people in the same environement may interpret it and react to it differently because of their unique genotypes Environment working with genes to make trait active Beavers father vs father in law cholesterol exam GXEs others people o GXEs can explain why children in the same family turn out differently We filter and experience things differently o GXEs can explain why rehabilitation efforts work for some people but not for o GXEs can explain why the environment does not have the same effect on all Is it Michal Jordans genes or his environment o Rememeber Caspi et al s article They found that the certain gene only had an effect in certain environments This Is a classic example of a GXE A growing body of empirical evidence has revealed the importance of GXEs in the etiology of crime and delinquency Gene X Environment correlations o We often see that an environment is related to a persons behaviors or their personality traits o We think that the environment caused their association o RGEs refer to the close association between genes and the environment RGEs o There are 3 types of RGEs Passive RGEs Active RGEs Evocative RGEs Passive RGEs o Children receive two elements from their parents genes and the environment o Passively receive both from their parents o The environment is largely a reflection of their parents genetic propensities Example Previous exam w IQ Violent parents cold abusive drawn detached Passively inherit genes and environment Evocative RGEs their genotype o People elicit certain responses from their environment based in large part on o Two people will elicit two responses from the same environment Example bad temper attractiveness Spanking aggression Active RGEs o Individuals play an active role in seeking out environments that are compatible with their genetic tendencies Engage in nuche picking Example thrill seeking and skydiving delinquent peers People select their environment friends can be based on genes which drive the traits Which genes may relate to antisocial behavior o Genes responsible for the production transportation and breaking down of neurotransmitters are the most promising o What are the neurotransmitters Chemical messengers that allow for communication between neurons We don t know a lot of the specific genes Neurotransmitters o Billions of neurons in the human brain o Thousands of connections for each neuron o Space between neurons Synaptic cleft or synapse gap Not physically connected o Neurotransmitters are released from one neuron where they cross the synaptic